We narrowed to 8,876 results for: sgrna

#165459

Escherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteria

Inigo Lasa

Dorado-Morales et al mBio. 2021 Feb 23;12(1). pii: mBio.03094

March 10, 2021

Academic Institutions and Nonprofits only

#201590

CRISPR/Cas9-mediated gene knock-out

Alexis Jourdain, Vamsi Mootha

Skinner et al Nat Metab. 2023 May;5(5):765-776. doi: 1

June 22, 2023

Academic Institutions and Nonprofits only

#64250

expresses sgRNA(tyr) under U6a promoter

Wenbiao Chen

Yin et al Genetics. 2015 Apr 8. pii: genetics.115.

May 7, 2015

Academic Institutions and Nonprofits only

#141090

This vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.

Jan-Willem Veening

Liu et al Cell Host Microbe. 2021 Jan 13;29(1):107

April 15, 2021

Academic Institutions and Nonprofits only

#138135

Targeted simultaneous C-to-T and A-to-G in rice

Caixia Gao

Sept. 23, 2020

Academic Institutions and Nonprofits only

#48672

Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG

George Church

Esvelt et al Nat Methods. 2013 Sep 29. doi: 10.1038/n

Oct. 22, 2013

Academic Institutions and Nonprofits only

#207103

pX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

April 24, 2024

Academic Institutions and Nonprofits only

#201635

CRISPR/Cas9-mediated gene knock-out

Alexis Jourdain, Vamsi Mootha

Skinner et al Nat Metab. 2023 May;5(5):765-776. doi: 1

June 22, 2023

Academic Institutions and Nonprofits only