We narrowed to 10,367 results for: ada
-
Plasmid#71268PurposeEntry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTq2CFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Npl4-Strep-HA
Plasmid#113495PurposeExpression of human Npl4 with C-terminal strep-HA tagDepositorInsertNpl4 (NPLOC4 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_NPY1.0
Plasmid#208675PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) sensor GRAB_NPY1.0 in mammalian cellsDepositorInsertGPCR activation based neuropeptide Y (NPY) sensor GRAB_NPY1.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1
Plasmid#160807PurposeExpress POLA1DepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 2xSTREP Cyclin F(LP35/36AA)
Plasmid#236467Purposetransient overexpression of Cyclin F in mammalian cellsDepositorInsertCyclin F (CCNF Human)
Tags2xSTREPExpressionMammalianMutation(LP35/36AA) first two amino acids of the F-box do…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
BRD4-N CRISPR
Plasmid#140651PurposeBRD4 tagging CRISPRDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
H11-mScarletSIIN
Plasmid#172438PurposeHipp11 targeting vector, expresses mScarlet-SIINFEKLDepositorInsertmScarlet-SIIN
UseMouse TargetingAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-CyOFP1
Plasmid#105799PurposeExpression of your protein of interest in fusion with orange fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 27240196). CyOFP1 is useful for multi-channel imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-CyOFP1ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Ufd1-Strep-HA
Plasmid#113474PurposeExpression of human Ufd1 with C-terminal strep-HA tagDepositorInsertUfd1 (UFD1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDisplay-GRAB_CRFmut
Plasmid#208656PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut in mammalian cellsDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut
ExpressionMammalianPromoterCMVAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cFos-XRI-V5
Plasmid#178058PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with V5 tag, under c-fos promoter.DepositorInsertXRI-V5
UseAAVTagsV5-MBPExpressionMammalianPromoterMouse c-fos promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-L398T-WPRE-SV40
Plasmid#101064PurposeAAV vector expressing CaMPARI2_L398T (Kd = 825nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2_L398T
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
aav-tnt-wtmrtfa-gfp
Plasmid#165037PurposeAAV-based delivery of wtMRTFA-GFP into cardiomyocytes in vivoDepositorAvailable SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IRES-puro-3xFLAG-NBR1
Plasmid#204546PurposeExpresses 3xFLAG-tagged NBR1 in mammalian cellsDepositorAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
hCGNL1-Myc-HA
Plasmid#236515PurposeFor expression of hParacingulinL1 in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pD40-His/V5-c-Myc
Plasmid#45597DepositorAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only