We narrowed to 22,051 results for: CAN
-
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF1
Plasmid#141188PurposeExpresses GFP-GIGYF1 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaCRIM
Plasmid#124921PurposeFor expression of Conserved Region In Middle deletion mutant of SIN1-GFP (delta139-267)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaPH
Plasmid#124922PurposeFor expression of Pleckstrin Homology domain deletion mutant of SIN1-GFP (delta376-486)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-VenusYFP-3AT
Plasmid#71269PurposeEntry clone containing Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTags4xGly linker and T3A pea Pisum sativum ribulose-1…Available SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
1073A(HomeR1)=pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159676PurposePlasmid provides the HomeR#1 gene drive element harboring a rescue, gRNA#1, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #1 via HDR.DepositorInsertpBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
ExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer-TAZ-S89A/S311A
Plasmid#213589PurposeDoxycycline inducible expression of TAZ-S89A/S311A cDNA in mammalian cellsDepositorAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER12 (miR-RUL)
Plasmid#46935PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoRI;1.4kb),can be replaced w mir30 based hairpin of interestDepositorInsertPheS Gly294
UseLentiviralAvailable SinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF3
Plasmid#65383PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-hTRF1-tagRFP-T
Plasmid#103811PurposeBLInCR 'Localizer' construct that marks telomeres and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3xVenusYFP-OcsT
Plasmid#71271PurposeEntry clone containing three repeats of Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsert3 times VenusYFP
UseGatewayTagsoctaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
KRAS-P34R
Plasmid#158527PurposeExpresses human KRAS P34R in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.DepositorInsertKRAS (KRAS Human)
Tags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialPromoterT5Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer-TAZ-S89A/S311A/S51A
Plasmid#213590PurposeDoxycycline inducible expression of TAZ-S89A/S311A/S51A cDNA in mammalian cellsDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFP
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT2/GD-IRES-GFP-CTNNB1
Plasmid#192868PurposeCarries a Sleeping Beauty (SB) transposon vector that can be used to deliver an activated human CTNNB1(S33Y) transgene into cells, when a source of SB transposase is also co-introduced.DepositorInsertsluc+
EGFP
CTNNB1
ExpressionMammalianAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-PCAF (delta5-53a.a.)
Plasmid#65388PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertPCAF (KAT2B Human)
TagsEmGFP and V5ExpressionMammalianMutationlost 13-159bp of the ORFPromoterCMVAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-LacI-tagRFP-T
Plasmid#103810Purpose'Localizer' construct that marks lacO arrays and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0
Plasmid#165984PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only