We narrowed to 10,219 results for: gnas
-
Plasmid#80875Purposemammalian expression of ALK3 K261RDepositorInsertALK3 (BMPR1A Human)
TagsHAExpressionMammalianMutationK261R (Kinase inactive)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pPGK-T7/2-CD44v2-10 (fl)
Plasmid#137824Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (fl) (CD44 Human)
TagsGFPExpressionMammalianMutationfull length and mutations A282T, T483A, N535D, S5…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L
Plasmid#224381PurposeLenti plasmid for generating GNB1L expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-hygro-STING R232
Plasmid#102608PurposeRetroviral vector to expression STING R232DepositorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-GSX2
Plasmid#96964PurposeDox-inducible expression of Gsx2 in mammalian cellsDepositorInsertGSX2 (Gsx2 Mouse)
ExpressionMammalianAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRC3 CTF-FLAG
Plasmid#217686PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertCELSR3 (CELSR3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2516Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P2-MDM2 (17-125)
Plasmid#62063PurposeExpression of human MDM2 (17-125) in e. coliDepositorInsertMDM2 (MDM2 Human)
TagsGSTExpressionBacterialMutationcontains residues 17-125PromotertacAvailable SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pLENTI-CAG-IRES-GFP
Plasmid#176992PurposeMammalian lentiviral expression vector encoding GLI1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-Flex/3'USS-hM4D/2A/GFP(ATG mut)
Plasmid#197892PurposeCan be used to generate AAV virus that will express hM4D/2A/GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInserthM4D/2A/GFP
UseAAVMutationN/APromoterEF1aAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
DOP1B_pcDNA6.2/EmGFP-Bsd
Plasmid#176979PurposeMammalian expression vector encoding DOP1B and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK6 wt
Plasmid#80882Purposemammalian expression of ALK6 WTDepositorAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
IFNAR2_pcDNA6.2/EmGFP-Bsd
Plasmid#176938PurposeMammalian expression vector encoding IFNAR2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRC3 CTFdeltaTA-FLAG
Plasmid#217719PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertCELSR3 (CELSR3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2522Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEAT8-137 M1V
Plasmid#173807PurposeExpression and purification of mature (no signal sequence) human alpha1-antitrypsin wildtype variant M1V (UniProt P01009) from E. coli BL21(DE3) cellsDepositorInsertSERPiNA1 (SERPINA1 Human)
ExpressionBacterialMutationE1M Otherwise this plasmid encodes the most commo…PromoterT7Available SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only