We narrowed to 12,832 results for: App
-
Plasmid#177840PurposeTango assayDepositorInsertC terminal 99 amino acid fragment of human Alzheimer Amyloid beta precursor Protein (APP Human)
ExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-HA-StayGold-IRESv4-HaloTag-tdMCP-tdP2A-tdPCP-mCherry
Plasmid#241142PurposeExpresses Anti-HA frankenbody-StayGold, HaloTag-tdMCP, and tdPCP-mCherry to track mature and nascent HA-tagged proteins and track MS2 and PP7-tagged mRNADepositorInsertsAnti-HA frankenbody
tdMCP
tdPCP
Tags(n2)oxStayGold(c4) E147D, 3x mCherry, and HaloTag…ExpressionMammalianPromoterCMVAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-StayGold-IRESv4-HaloTag-tdMCP-tdP2A-tdPCP-mCherry
Plasmid#241143PurposeExpresses Anti-GCN4 scFv-StayGold, HaloTag-tdMCP, and tdPCP-mCherry to track mature and nascent SunTag-tagged proteins and track MS2 and PP7-tagged mRNADepositorInsertsAnti-GCN4 scFv
tdMCP
tdPCP
Tags(n2)oxStayGold(c4) E147D, 3x mCherry, and HaloTag…ExpressionMammalianPromoterCMVAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-HA-mScarlet3-tdP2A-Frankenbody-FLAG-mEGFP-IRESv4-HaloTag-tdMCP
Plasmid#241140PurposeExpresses Anti-FLAG frankenbody-mScarlet3, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent HA and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-FLAG frankenbody
anti-FLAG frankenbody
tdMCP
TagsHaloTag, mEGFP, and mScarlet3ExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-sfGFP-tdP2A-Frankenbody-FLAG-mScarlet3-IRESv4-HaloTag-tdMCP
Plasmid#241141PurposeExpresses Anti-GCN4 scFv-sfGFP, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent SunTag and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-GCN4 scFv
anti-FLAG frankenbody
tdMCP
TagsHaloTag, mEGFP, and sfGFPExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AB-GFP
Plasmid#72203Purposescreen AB42 variants for aggregationDepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/FLAG/HA-DEST PABPC4
Plasmid#19882DepositorAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLV.EF1α.mEmerald.CD9.miR9T
Plasmid#170452PurposeLentiviral plasmid that encodes mEmerald-CD9 fusion protein with microRNA 9 tandem cassette to restrict expression to microglia with EF1-alpha promoter.DepositorAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-puro
Plasmid#158463PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-blast
Plasmid#158464PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CTSB
Plasmid#158443PurposeGateway Cloning compatible entry vector for the human CTSB gene.DepositorInsertCTSB (CTSB Human)
UseGateway entry vectorAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-G418
Plasmid#158465PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only