-
Plasmid#76381Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K3DepositorInsertMAP2K3 (MAP2K3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1D gRNA (BRDN0001149348)
Plasmid#76716Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1DDepositorInsertCSNK1D (CSNK1D Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorInsertsesRNA for mouse Rorb (Rorb Mouse)
UseTagsExpressionMammalianMutationPromoterhSynAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051d_sgCiPELO #1
Plasmid#229017PurposeExpression of CRISPRi PELO sgRNA #1DepositorInsertPELO (PELO Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MYC_2)-PGKpuroBFP-W
Plasmid#211970PurposeExpress gRNA against MYC with puro and BFPDepositorInsertsgRNA targeting MYC (MYC Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Downstream_gRNA_1
Plasmid#195136PurposegRNA in a third generation gRNA backbone with mCherry, targeting region immediately downstream of MDM4, to be used with MDM4_Deletion_Upstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Downstream gRNA 1 (MDM4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrip1#1/Cre
Plasmid#193203PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Brip1 geneDepositorInsertsgBrip1#1 (Brip1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2c#1/Cre
Plasmid#173652PurposeExpresses a Kmt2c-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2c (Kmt2c Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErcc4#1/Cre
Plasmid#173593PurposeExpresses a Ercc4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ercc4 (Ercc4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-12
Plasmid#129064Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA12 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA12 (mouseTSDR)
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA targeting human SLC12A5 gene stop codon
Plasmid#158577PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInsertsgRNA targeting human SLC12A5 gene stop codon
UseCRISPRTagsCas9 and GFPExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgMARK3
Plasmid#138706PurposeExpresses a human MARK3-targeting sgRNA and Cas9DepositorInsertsgMARK3 human (MARK3 Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Exoc7-Ex5&10
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermU6 promoterAvailable sinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#3
Plasmid#106347Purposesmall guide RNA #3 against RRM-coding region of Dnd1 gene locusDepositorInsertDnd1 (Dnd1 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
C17orf75 gRNA (BRDN0001146368)
Plasmid#78078Purpose3rd generation lentiviral gRNA plasmid targeting human C17orf75DepositorInsertC17orf75 (C17orf75 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only