We narrowed to 13,860 results for: GFP expression plasmids
-
Plasmid#199220PurposeLPUtopia-7 matching RMCE donor plasmid with GFP Negative-Feedback circuit (mNF-GFP). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInserthTetR::P2A::EGFP
TagsEGFPExpressionMammalianPromoterCMV D2ir promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)5
Plasmid#127523PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 5 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 5 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)7
Plasmid#127524PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 7 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 7 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)9
Plasmid#127525PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 9 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 9 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)5
Plasmid#127506PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 5 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 5 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)7
Plasmid#127507PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 7 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 7 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)2
Plasmid#127521PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 2 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 2 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)4
Plasmid#127505PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 4 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60231PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA
Plasmid#160141PurposeCre- dependent expression of Sun1GFP for nuclei isolationDepositorInsertSun1-GFP (Sun1 Mouse)
UseAAVTagsGFPExpressionMammalianMutationN-truncated: removed amino acids 1-207, retained …PromoterEf1aAvailable SinceMarch 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-Jaws-GFP-ER2
Plasmid#65016PurposeAAV-mediated expression of Jaws-ER2 under the human synapsin promoterDepositorInsertJaws-GFP-ER2
UseAAVTagsER2 and GFPExpressionMammalianMutationK200R W214FPromoterhuman synapsinAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hHelios-IRES-GFP
Plasmid#74047Purposeretroviral plasmid for expression of FLAG-tagged human Helios (IKZF2) corresponding to cDNA from NM_001079526.1DepositorInserthuman Helios (IKZF2) (IKZF2 )
UseRetroviralTagsFLAGExpressionMammalianMutationencodes shorter version of human HeliosPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hIKAROS-IRES-GFP
Plasmid#74046Purposeretroviral plasmid for expression of FLAG-tagged human Ikaros corresponding to cDNA from XM_011515058.1DepositorInserthuman Ikaros (IKZF1) (IKZF1 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FLEX-rc[Chronos-GFP]
Plasmid#62725PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1αAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[CoChR-GFP]
Plasmid#62724PurposeAAV-mediated expression of CoChR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertCoChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-moxGFP-P2A-T2A-Puro
Plasmid#176893PurposeSleeping Beauty transposon-based vector for mammalian polycistronic expression of moxGFP and two additional genes of interestDepositorInsertmoxGFP-P2A-T2A
UseTransposonTagsmoxGFPExpressionMammalianPromoterEF1a/RPBSAAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLPX-rc [Chronos-GFP]
Plasmid#122102PurposeAAV-mediated expression of Chronos-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
HT115_pAAV_hSyn-DiO-SomQuasAr6b_EGFP-P2A-somCheRiff_HA
Plasmid#178827PurposeCre-on bicistronic expression of QuasAr6b-based Optopatch under an neuronal promoterDepositorInsertSomQuasAr6a_EGFP-P2A-somCheRiff_HA
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFP, HAExpressionMammalianPromoterhSynAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only