We narrowed to 6,854 results for: itch
-
Plasmid#103802PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only
-
SspB-HaloTag-DHPH-ITSN1
Plasmid#176113PurposeHeterodimerization with iLID, Cdc42 activationDepositorInsertITSN1 (ITSN1 Human)
ExpressionMammalianAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
SspB-iRFP-DHPH-ITSN1
Plasmid#176117PurposeHeterodimerization with iLID, Cdc42 activationDepositorInsertITSN1 (ITSN1 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
Plasmid#122986PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(micro)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains R73Q "micro" mutation, Bo…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mVenus-PA-Rac1-C450A
Plasmid#22021PurposeExpression of Rac1 fused with light-insensitive LOV2 (C450A mutation)DepositorInsertPA-Rac1-C450A (RAC1 Human, Avena sativa (oat))
Tags6X His and mVenusExpressionBacterial, Insect, and Mamm…MutationLOV domain contains the light-insensitive C450A m…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-axon-jYCaMP1s
Plasmid#135421PurposeAxon-targeted yellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variantDepositorHas ServiceAAV1InsertjYCaMP1s
UseAAVTagsGAP43 axon targeting sequenceExpressionMammalianPromoterhSynAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-D387A
Plasmid#59778PurposeExpresses optoFGFR1 with mutation in PHR to suppress homointeraction, thus cannot be activated by lightDepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hTRF1
Plasmid#103801PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-INPP5E(D556A)
Plasmid#79563Purposeexpression of mCherry-tagged CRY2PHR fused to catalytically dead INPP5EDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Cry2-mCherry-coiled coil
Plasmid#166448PurposeExpresses fusion of CRY2PHR with mCherry and YAP Coiled-coil domainDepositorInsertCry2, mCherry, coiled coil(298-359) (CRY2 Human)
UseLentiviralAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
iLID-tdTomato-Omp25
Plasmid#214400PurposeExpresses fusion of iLID with tdTomato and transmembrane domain of Omp25DepositorInsertiLID-tdTomato-Omp25 (Synj2bp Synthetic, Rat)
TagsiLID-TdTomato-Omp25ExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-LacI-tagRFP-T
Plasmid#103810Purpose'Localizer' construct that marks lacO arrays and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNMT3ACD-CRY2-EGFP
Plasmid#82556PurposeEncodes DMNT3 under LITE2.0 systemDepositorUseAAVTags2A, NLS(alpha-imp), and NLS-VP64ExpressionMammalianMutationCRY2PHR (N-terminal photolyase homology region do…PromoterEF-1alphaAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TET1CD-CRY2-EGFP
Plasmid#82555PurposeEncodes TET1 under LITE2.0 systemDepositorUseAAVTags2A, NLS(alpha-imp), and NLS-VP64ExpressionMammalianMutationCRY2PHR (N-terminal photolyase homology region do…PromoterEF-1alphaAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPig-hEF1a-Cry2PHR-LRP6c-Puro-Blind
Plasmid#249712PurposeExpresses optogenetic LRP6 in mammalian cells; no fluorescent proteins. Plasmid contains a puromycin selection marker.DepositorAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-IRES2-CRY2-STIM1(238-448)
Plasmid#248295PurposeAn expression construct encoding a CRY2-fused STIM1 fragment (a.a.238-448) linked to EGFP through an IRES2 element.DepositorInsertEGFP and CRY2-fused STIM1 fragment (a.a.238-448) (STIM1 )
TagsEGFPMutationdeleted amino acids 1-237,449-685PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-TTHA
Plasmid#232479PurposeTetracycline inducible PiggyBac vector expressing bacterial TTHA1718 (TTHA) gene gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertThermus thermophilus HB8
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCEP4 TAPBPR-TM-TN6
Plasmid#178650PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TM (E205K, R207E, Q209S, Q272S)DepositorInsertTAPBPR (TAPBPL Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationE205K, R207E, Q209S, Q272S, switched transmembran…PromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only