We narrowed to 6,854 results for: itch
-
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pPHR-EYFP-hHP1β
Plasmid#103829PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 Delta RC
Plasmid#164522PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions K164A/H165A)DepositorInsertNSP1 Delta RC (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(ER)
Plasmid#228941PurposeStable expression of EGFP-LOV2(N538E)-BAX-Cyb5a in mammalian cells. Photoactivatable BAX localizes on ER and induces ER rupture upon blue light stimulation.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationN-terminus and C-terminus are deleted. BAX(3-171)…Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Rat, Synthetic)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mCherry-Rab11
Plasmid#140573PurposeFor use in light-induced protein inactivation through the interaction with CRY2DepositorTagsmCherryExpressionMammalianPromoterCMV IE94Available SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-hTRF1-tagRFP-T
Plasmid#103811PurposeBLInCR 'Localizer' construct that marks telomeres and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PA-DAD-dark
Plasmid#53096PurposeExpresses dark mutant PA-DAD in mammalian cells, an optogenetic tool to activate endogenous diaphanous related formins in live cells using light with LOV2 in the closed conformationDepositorInsertLOV(dark)-6aa-DAD
Tags6x His and mVenusExpressionBacterial, Insect, and Mamm…MutationL47F and C49S in Venus; C450M mutation in LOV2Available SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-pGK-nAChRb2(E61C)-IRES-GFP
Plasmid#164777Purposecysteine mutated nAChR beta2 subunit (E61C) for the attachment of a photoswitchable tethered ligandDepositorInsertnAChR b2 E61C - IRES- GFP (Chrnb2 Mouse)
UseLentiviralExpressionMammalianMutationE61CPromoterpGKAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-IDR1-mCherry-Cry2
Plasmid#177125PurposeExpress IDR1 fragment of YTHDC1 with mCherry and CRY2 tag for Optodroplet AssayDepositorInsertYTHDC1 (IDR1 domain) (YTHDC1 Human)
TagsmCherry-CRY2ExpressionMammalianMutationIDR1 domain onlyPromoterSFFVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-CMV-nAChRb2(E61C)-IRES-GFP
Plasmid#164779Purposecysteine mutated nAChR beta2 subunit (E61C) for the attachment of a photoswitchable tethered ligandDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHR-mCherry-hHP1β
Plasmid#103830PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
BAP1-010
Plasmid#68366Purposestable expression of BAP1 delta 221-238 in mammalian cellsDepositorInsertBAP1 (BAP1 Human)
ExpressionMammalianMutationdelta 221-238, splice variant found in human meso…PromoterCMVAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 124A/125A
Plasmid#164523PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions R124A/K125A)DepositorInsertNSP1 124A/125A (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRY2low-tdTomato-Raf1
Plasmid#104176PurposeExpresses fusion of CRY2low mutant (CRY2 aa1-491 R489E A491D) with tdTomato and Raf1DepositorExpressionMammalianMutationCRY2 aa 1-491 truncation, R489E A491DPromoterCMVAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRY2low-mCherry-Raf1
Plasmid#104066PurposeExpresses fusion of CRY2low mutant (CRY2 aa1-491 R489E A491D) with mCherry and Raf1DepositorExpressionMammalianMutationCRY2 aa 1-491 truncation, R489E A491DPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIα-FLAG-STIM1(238-685)
Plasmid#248299PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the CaMKIIα promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterCamKllaAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-EGFP-CRY2-STIM1(318-450)
Plasmid#248302PurposeAn AAV construct designed to express a CRY2-fused truncated STIM1 fragment (a.a.318–450) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 Human)
UseAAVTagsEGFPExpressionMammalianMutationdeleted amino acids 1-317,451-685PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-FLAG-STIM1(238-685)
Plasmid#248301PurposeAn AAV construct designed to express a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) under the control of the GfaABC1D promoter.DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238-685) (STIM1 Human)
UseAAVTagsFLAGExpressionMammalianMutationdeleted amino acids 1-237PromoterGfaABC1DAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only