We narrowed to 7,003 results for: Proc
-
Plasmid#127255PurposeExpresses the C terminal segment of human ELL2 in mammalian cellsDepositorInsertELL2 (C-terminal end) (ELL2 Human)
UseOtherExpressionMammalianMutationcontains only the last 389 aaPromoterpEF1aAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met1ILeu ELL2
Plasmid#127258PurposeFor in vitro translation of human ELL2 with Met1 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met1 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet1 to Ileu by QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
ELL2mRNA+polyA
Plasmid#127256PurposeFor in vitro translation of human ELL2 with 30 nt pA tailDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationshortens 3'UTR to 40 bp adds A30 tailPromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NH2end ELL2
Plasmid#127252PurposeExpresses the N terminal segment of human ELL2 in mammalian cellsDepositorInsertELL2 (1-287) (ELL2 Human)
UseOtherTagsHis6XExpressionMammalianMutationcontains only amino acids 1-289PromoterpEF1aAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2
Plasmid#127268PurposeFor in vitro translation of WT ELL2 with HA tag inserted near N-termDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationELL2mRNA+polyA with HA tag inserted at aa12 betwe…PromoterT7Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL1 no-stop
Plasmid#123210PurposeGateway entry clone encoding human GABARAPL1 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL2 no-stop
Plasmid#123211PurposeGateway entry clone encoding human GABARAPL2 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.3
Plasmid#46682PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.3 (MIR16-1 Synthetic, Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.1
Plasmid#46680PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.1 (MIR16-1 Synthetic, Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXB6-WG-MSCV
Plasmid#20993DepositorInsertHOXB6 (HOXB6 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationW->G mutation in YPWM interaction motif for PB…Available SinceAug. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-GABARAPL1-GFP
Plasmid#123112PurposeExpresses 3xFLAG-GABARAPL1-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPL1DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-GABARAPL2-GFP
Plasmid#123113PurposeExpresses 3xFLAG-GABARAPL2-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPL2DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOG44_FLP_recombinase (pEHA1338)
Plasmid#209087PurposeFLP recombinase for FRT-mediated integrationDepositorInsertFLP recombinase
ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX313-Renilla luciferase
Plasmid#118016PurposeConstitutive expression of Renilla luciferaseDepositorInsertRenilla luciferase
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N-Drd1
Plasmid#104358PurposeExpresses mouse dopamine receptor subtype 1 with EGFP fused to the C-terminus of the receptor. Localizes to primary cilia.DepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX313-Firefly luciferase
Plasmid#118017PurposeConstitutive expression of Firefly luciferaseDepositorInsertFirefly luciferase
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
CHGA-eGFP
Plasmid#228569PurposeExpresses GFP-tagged human Chromogranin A in mammalian cellsDepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-GABARAPL1 G116
Plasmid#123119PurposeExpresses EGFP-GABARAPL1 G116 in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
TagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(C128S/D156A)-mCherry
Plasmid#35502PurposeAAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationC128S and D156APromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only