We narrowed to 9,364 results for: tre promoter
-
-
Cx30-msfGFP
Plasmid#69019PurposeExpresses human Cx30 (GJB6 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a_FOXA3_P2A_Hygro_Barcode
Plasmid#120440PurposeBarcoded lentiviral vector to express FOXA3 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF14_P2A_Hygro_Barcode
Plasmid#120500PurposeBarcoded lentiviral vector to express KLF14 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN104
Plasmid#91633PurposeExpress sgRNA targeting human KCTD13DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN105
Plasmid#91634PurposeExpress sgRNA targeting human KCTD13DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hRad51(S208E-A209D)–Cas9(D10A)
Plasmid#125561PurposeExpresses the hRad51(S208E-A209D)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAD-LyseR (in lacZ deficient strain)
Plasmid#99245PurposeFor autolysate production in lacZ deficient (lac operon deletion) E. coli BL21-Gold-dLac (DE3) strain: constitutively expresses phage lambda endolysin (gene R)DepositorAvailable SinceOct. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYSD313
Plasmid#212931PurposeEncodes the Aga2 signal peptide, mRuby2 fluorescent protein HA-tagged Sed1p yeast surface display anchor protein with pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertSed1 (SED1 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
hRad51(A190L-A192L)–Cas9(D10A)
Plasmid#125562PurposeExpresses the Rad51(A190L-A192L)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPINF AtMKK5
Plasmid#228396PurposeRecombinant expression of His6-tagged Arabidopsis thaliana MKK5 in E. coliDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF17_P2A_Hygro_Barcode
Plasmid#120503PurposeBarcoded lentiviral vector to express KLF17 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST PKAKTRClover
Plasmid#59153PurposeLentiviral vector to express PKA KTR mClover under PGK promoter (With Puromycin Resistance)DepositorAvailable SinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a_ETV2_P2A_Hygro_Barcode
Plasmid#120436PurposeBarcoded lentiviral vector to express ETV2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF1_P2A_Hygro_Barcode
Plasmid#120488PurposeBarcoded lentiviral vector to express KLF1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only
