We narrowed to 36,199 results for: Cre
-
Plasmid#177823PurposeSite-specific mutagenesis of tagBFP for the purposes of creating a site-specific U:A mispair for the purposes of measuring UDG activity via Host Cell Reactivation (HCR).DepositorInserttagBFP_A191G
ExpressionMammalianMutationA191GPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-OC-IRES-BSD
Plasmid#53118PurposeTo create stable cell clones with high-level expression of Cas9 and OCT1DepositorInsertsUseLentiviralTagsIRES-BSD, NLS, and P2AExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR2 (Retro)
Plasmid#222688PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianMutationPGK without BbsI cutsiteAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR3 (Retro)
Plasmid#222689PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianMutationPGK without BbsI cutsiteAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPP5233
Plasmid#128715PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcM-hopM1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPReporter-mCherry
Plasmid#65008PurposeE. coli reporter vector with MCS for inserting bacterial promoter region through 5' end of gene of interest, upstream and in-frame with mCherry reporter.DepositorInsertmCherry
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterUser-definedAvailable SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCPP5060
Plasmid#128716PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcN-hopN1
ExpressionBacterialAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
RS35075_pMQ30_KO_Kan
Plasmid#185390PurposeNon-replicating vector used to create markerless deletion of RR42_RS35075 in C. basilensis 4G11DepositorInsertsRR42_RS35075 upstream flanking homology region
RR42_RS35075 downstream flanking homology region
nptII kanamycin resistance marker
ExpressionBacterialAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSNV2 CHER NLS cop1at(335-675)
Plasmid#44972DepositorInsertmCherry-NLS-COP1 (COP1 Mustard Weed)
TagsNLS and mCherryExpressionMammalianMutationdeleted amino acids 1-334PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
JI401: Ad5 E1A/Hexon qRT-PCR standard
Plasmid#131753PurposePlasmid standard containing regions of the Ad5 E1A and Ad5 Hexon genes to create a qRT-PCR standard curve for detection of replication competent adenovirus (RCA).DepositorInsertsAd5 E1A gene fragment
Ad5 Hexon gene fragment
UseStandard for qrt-pcrPromoterN/AAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pvha6-AgDD
Plasmid#80626Purposecreate protein aggregates in C. elegansDepositorAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS_375
Plasmid#182132Purposeexpresses retron RNA, ec.86 Reverse Transcriptase, CspRecT SSAP, and mutL* to create a specific rifampicin resistance mutation while inhibiting MMRDepositorInsertsretron RNA
ec.86 RT
CspRecT
Mutationincorporated rifampicin-resistance-conferring don…Available SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1988
Plasmid#49119PurposeAAV plasmid with CAGGS promoter driving expression of iCre.DepositorInsertssAAV-CAGGS-iCre
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
Direct-seq_lentiGuide-Puro-Loop2-8A8G
Plasmid#157983PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf117
Plasmid#12805PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf117
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tail-8A8G
Plasmid#157981PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2117
Plasmid#49142PurposeAAV plasmid with smCBA promoter driving expression of iCre.DepositorInsertssAAV-smCBA-iCre
UseAAVExpressionMammalianPromotersmCBAAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOCC94
Plasmid#118912Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with honey bee melitine secretion signal, N-terminal MBP, cleavable with 3C protease, and C-terminal eGFP-HIS6DepositorInsertNcoI-HBMss-MBP-3C-NotI-ccdB-AscI-eGFP-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and eGFP-HIS6ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only