We narrowed to 174,961 results for: Gene
-
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFlpStop-HDR-UAS-2.1-tdTom
Plasmid#89148PurposeFlpStop plasmid for CRISPR/HDR. Has MCS for homology armsDepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoter5XUAS, 3XP3-dsRedAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBbA8k-RFP
Plasmid#35273DepositorInsertRFP
UseSynthetic BiologyExpressionBacterialPromoterBADAvailable SinceFeb. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-T2A-ACREB-WPRE
Plasmid#40867DepositorInsertACREB
UseAAVPromoterCMVAvailable SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
PKC delta DN
Plasmid#16389DepositorInsertPKC delta isoform 2 (Prkcd Mouse)
TagsHAExpressionMammalianMutationDominant negative (kinase inactive): K376RAvailable SinceApril 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMKV059
Plasmid#133314PurposeBeYDV viral replicon on T-DNA backbone expressing Firefly Luc+ and IPTDepositorInsertLuc+, IPT
ExpressionPlantPromoterAtUbi10, 35SAvailable SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDZ416 (24PP7SL loxP-Kan-loxP)
Plasmid#45163DepositorInsert24xPP7 Stem Loop Cassette
UseCre/LoxAvailable SinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
ATF4 5: 5’ATF4.GFP
Plasmid#21852DepositorInsertATF4
TagsEGFPExpressionMammalianAvailable SinceSept. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRH2521
Plasmid#84380PurposeExpression of sgRNA from a imyc promoter (Pimyc)DepositorInsertsgRNA cloning site
UseCRISPRExpressionBacterialAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC016-gPsp-Control
Plasmid#233611PurposeExpression of guide RNA for PspCas13bDepositorInsertControl gRNA
UseCRISPRAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDropVn
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAM5057
Plasmid#120085PurposeBroad host range plasmid. Theophylline inducible expression of YFP in various cyanobacteria.DepositorInsertRSF1010 Y25F aadA PconII theophylline riboswitch F with myc-yfp reporter
UseOtherAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVPRT-tTR-KRAB
Plasmid#11648PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPrion promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthPrion, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSADdeltaG-F3
Plasmid#32634DepositorInsertB19N, B19P, B19M and B19L
ExpressionMammalianMutationIn frame insertion of Ser after aa10 in M (matrix…PromoterCMVAvailable SinceOct. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAC-EPSILON
Plasmid#53276PurposeContains ctrE, crtB, and crtI genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and the lcyE gene of Lactuca sativa and thereby produces epsilon-carotene in Escherichia coliDepositorInsertlcyE
UseLow copy number bacterial cloning vectorPromoterlacAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-HBH-kanMX6
Plasmid#26872DepositorInsertHBH tag
UsePcr tagging yeastAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pVT36b
Plasmid#184437PurposeCRISPR/Cas9 plasmid, containing ScARS, IoURA3, iCas9, RPR1’-tRNA_Leu promoter, and sgRNA scaffoldDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB2224
Plasmid#67547PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked kanMX marker, integration into S. cerevisiae XI-2 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSS2.1-mNeongreen
Plasmid#241016PurposeExpresses mNeongreen under control of Msg promoterDepositorInsertsmNeongreen
blasticidin-S deaminase
ExpressionYeastAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS1-mNeongreen
Plasmid#241014PurposeExpresses mNeongreen under control of Msg promoterDepositorInsertsmNeongreen
blasticidin-S deaminase
ExpressionYeastAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only