We narrowed to 5,290 results for: crispr cas9 expression plasmids
-
Plasmid#80263Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-i53
Plasmid#92170Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant (i53) that is a selective inhibitor of 53BP1DepositorInserti53
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable SinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
EGFP gRNA (BRDN0000563266)
Plasmid#80036Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS34.EF1α<GFP-2A-Cas9-RC
Plasmid#207404PurposeCas9-RC and GFP from an EF1α promoter. High-performance knockin through DSB repair by homology-directed recombination (HDR) or homology-mediated end joining (HMEJ). [Lab plasmid ID: N213]DepositorInsertCas9-RC
UseCRISPR and Synthetic BiologyTagsGFP-2AExpressionMammalianPromoterEF1αAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149198)
Plasmid#80248Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMART-sgRNA (Sp)
Plasmid#80427PurposeU6 promoter driven sgRNA expression plasmid. Annealed oligonucleotides encoding crRNA sequence are ligated into BbsI site.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
piCRg Entry
Plasmid#58904PurposeCas9/gRNA Entry expression plasmidDepositorInserthSpCas9
ExpressionMammalianAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
AZ64_pE.DonorCLYBL.TS
Plasmid#199228PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for EGFP reporter
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
ePE2
Plasmid#202029PurposePrime Editing plasmid for tag insertionDepositorInsertCas9,
UseCRISPRExpressionPlantAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC2_2_dCas9_VP64_sgRNA
Plasmid#163707PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VP64 activation domainDepositorInsertsdCas9
VP64+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Cas9C-VPR
Plasmid#80933PurposeExpresses Cas9C-VPR in mammalian cells.DepositorInsertCas9C-VPR
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-P2A-GFP
Plasmid#222996PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-EGFP markerDepositorInsertPE7-P2A-EGFP
TagsP2A-EGFP, SV40 bpNLS, and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-TET2BlastR-Cas9-TagBFP
Plasmid#236726PurposeDox Inducible Cas-TagBFP expressionDepositorInsertCas9-TagBFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJC2528 - CLYBL-Neo-CAGGS-LSL-dCas9-TagBFP-KRAB-CLYBL (LSL-CRISPRi)
Plasmid#250253PurposeHomology donor for knock-in of CRISPRi system into CLYBL locus with addgene plasmids 62196 and 62197. Lox-Stop-Lox requires cre delivery for activation.DepositorInsertdCas9-mTagBFP-KRAB
UseCRISPRTagsHA-2xSV40 NLS-mTagBFP-KRABExpressionMammalianPromoterCAGGSAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only