We narrowed to 953 results for: dcas9, grna
-
Plasmid#193136PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA3 (GB1724) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G3aG2b.1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2879
Plasmid#193116PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.5
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSJ105
Plasmid#208859PurposeExpresses SoxS activation domain and gRNA targeting 105 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 105
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
KTK_095
Plasmid#180524PurposedCas9 KTK compatible plasmid. Contains dCas9 and lacZ dropout region with flanking D1.1 overhangs for insertion of gRNA expression assemblyDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2890
Plasmid#193133PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "d site" (-120 from TSS) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1dG2b.1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAFi-dHdrA
Plasmid#184907Purposecarrying CRISPR/dCas9 system for gene knockdown in Acidithiobacillus ferriduransDepositorInsertCm-sgRNA-dCas9
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCB-CRISPRi
Plasmid#221136PurposeCoxiella burnetii CRISPRi plasmid without sgRNA construct. Expresses 3xF-dCas9.DepositorInsert3xF-dCas9
UseCRISPRTags3xFLAGExpressionBacterialMutationPromotercbu1169 promoterAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSJ107-2x
Plasmid#208812PurposeExpresses SoxS activation domainand gRNA targeting two copies of 107 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 107-2x_mRFP
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSJ106-2x
Plasmid#208860PurposeExpresses SoxS activation domain and gRNA targeting two copies of 106 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 106-2x_mRFP
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-UniSAM
Plasmid#99866PurposeEncodes for Cas9-VP64, MS2-p65-HSF1, mCherry and for the gRNA 2.0DepositorInsertUniSAM-mCherry + U6-gRNA2.0
UseCRISPR and Synthetic Biology; Dcas9-sam activationTagsExpressionMammalianMutationBbsI sites in CDS were ablated by consensus mutat…PromoterEF1aAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS614_pTetR-P2A-BFPnls/sgNS
Plasmid#108650PurposeNon-specific Spy sgRNA under U6 promoterDepositorInsertsNon-specific sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianMutationPromoterU6 and hPGKAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS613_pTetR-P2A-BFPnls/sgTelo
Plasmid#108649PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInsertsTelomere-targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianMutationPromoterU6 and hPGKAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
GB3277
Plasmid#193131PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.4
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2888
Plasmid#193126PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.4
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2886
Plasmid#193124PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only