We narrowed to 83,772 results for: Mycs
-
Plasmid#162107PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-HA-FLAG
Plasmid#162112PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-HA-FLAG
UseLentiviralTagsStrepTagII-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-HA
Plasmid#162089PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-HA
Plasmid#162080PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53-Pac-TRE-3xFlag-Neurog1-attB53
Plasmid#183613PurposeRMCE vector to shuttle puromycin resistance and TRE-3xFlag-Neurog1 cassettes into attP50-flanked landing pad. Designed for use with pmROSA26-attP50-Neo-mKate2-3xNLS-attP50 vector (Addgene 183609).DepositorAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUC2::GNSI (NrsR)
Plasmid#121537PurposeThis plasmid contains a CYC1pr driven GNSI reporter and flanking homology to SUC2. Digestion with NotI, SacI, and EcoRV, allows integration at the SUC2 locus.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
NrsR
TagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …Available SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNK3203
Plasmid#219749PurposeDVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - mcitHispS - tSV40
ExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-HA-FLAG-AU1
Plasmid#162098PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to HA-FLAG-AU1
UseLentiviralTagsHA-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYL236
Plasmid#173184PurposeCRISPR donor plasmid for making the WT EZH2 control cell line. It contains a puromycin resistance gene and an mCherry geneDepositorAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBullet-tgn-c
Plasmid#53072Purposedestination vector with ECFP-trans golgi network marker (VTI12) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-c
Plasmid#53074Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Dakap-Venus-cpVenus-FLARE-AKAR
Plasmid#123338PurposeMitochondria-targeted yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertDAKAP-Venus-cpVenus-FLARE-AKAR
TagsN-terminal 30 amino acids from DAKAP1, Venus, and…ExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-GFP-FLARE-AKAR
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
Tags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-c
Plasmid#53078Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only