We narrowed to 10,673 results for: yeast
-
Plasmid#15372DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only
-
FLAG-Med11 pBacPAK8
Plasmid#15373DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
myc-Med22 pBacPAK8
Plasmid#15374DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
myc-Med31 pBacPAK8
Plasmid#15375DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
myc-Med19 pBacPAK8
Plasmid#15376DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300-Aar1-BCPp-NLS-2xmCH_STR1p-cYFP-STR1g_STR2p-nYFP-STR2g
Plasmid#254407PurposeBiFC plasmid with cYFP-STR and nYFP-STR2 expressed from their native promoters and MtBCP1-NLS- 2X mCherry.DepositorInsertsSTR promoter-nYFP-STR_STR2 promoter-cYFP-STR2
M. truncatula BCP1 promoter - NLS-2X-mCherry
ExpressionPlantPromoterMtBCP1 promoter and STR promoterAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
Aga2p-TEVcs-LacAnc100-myc_pCTCON2
Plasmid#245298Purposeexpresses LaccID on the yeast surfaceDepositorInsertAga2p-LacAnc100
ExpressionYeastAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30-LacAnc100
Plasmid#234653PurposeExpresses LacAnc100 variant in yeastDepositorInsertLacAnc100
TagsHRV 3C protease site-GSG linker-8xHis tagExpressionYeastPromoterGal1pAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221112PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterSTE3Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221114PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Tef1 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only