We narrowed to 14,335 results for: Ung;
-
Viral Prep#84446-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (#84446). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] plasmid DNA. CAG-driven, Cre-dependent expression of Jaws-KGC-tdTomato-ER2 for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP (AAV8)
Viral Prep#137148-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP (#137148). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP plasmid DNA. nEF-driven, Cre and Flp-dependent expression of Arch3.3-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre and Flp-dependent)Available SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (AAV1)
Viral Prep#84445-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (#84445). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] plasmid DNA. CAG-driven, Cre-dependent Jaws-GFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFP (Cre-dependent)Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP (AAV8)
Viral Prep#137140-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP (#137140). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP plasmid DNA. nEF-driven, Cre-dependent expression of ChR2(E123T/T159C)-EYFP (inhibited in presence of Flp) for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre-dependent)Available SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP (AAV8)
Viral Prep#137150-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP (#137150). In addition to the viral particles, you will also receive purified pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP plasmid DNA. nEF-driven, Flp-dependent expression of Arch3.3-EYFP (inhibited in presence of Cre) for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Flp-dependent)Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Archon1-KGC-GFP-ER2 (AAV8)
Viral Prep#115892-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-Archon1-KGC-GFP-ER2 (#115892). In addition to the viral particles, you will also receive purified pAAV-Syn-Archon1-KGC-GFP-ER2 plasmid DNA. Syn-driven Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] (AAV8)
Viral Prep#115893-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] (#115893). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] plasmid DNA. Syn-driven, Cre dependent Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFP (Cre-dependent)Available SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon/Von eYFP (AAV Retrograde)
Viral Prep#137164-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-nEF-Con/Fon/Von eYFP (#137164). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon/Von eYFP plasmid DNA. nEF-driven, Cre, Flp and VCre-dependent expression of EYFP. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre, Flp and VCre-dependent)Available SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (AAV Retrograde)
Viral Prep#84445-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (#84445). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] plasmid DNA. CAG-drive, Cre-dependent Jaws-GFP for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFP (Cre-dependent)Available SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 (AAV5)
Viral Prep#108422-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 (#108422). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 plasmid DNA. CAG-driven, Cre dependent Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_Pro_NHis_CAvi
Plasmid#234394PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsMHHHHHHSSGVDLG and SSKGGYGLNDIFEAQKIEWHEExpressionBacterialPromoterT7Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_Hel_NAviCHis
Plasmid#234397PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsMHHHHHHSSGVDLG and SSKGGYGLNDIFEAQKIEWHEExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-hVASA-KO-WPRE
Plasmid#214124PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInserthKO
ExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_FL_NHisTEV_CThromAvi
Plasmid#234385PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_Pro_NHisTEV_CThromAvi
Plasmid#234386PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFGL1009
Plasmid#119080PurposeIntroducing ectopic integration at the defined fungal ILV2-locus, based on SRR (Sulfonylurea Resistance Reconstitution).DepositorTypeEmpty backboneUseFungal expressionAvailable SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBHt2G-RFP
Plasmid#107162PurposeGolden-Gate compatible fungal transformation vector carrying Hygromycin Resistance w RFP screening cassette (RFP knocked out by GG reaction, allowing for red-white screening)DepositorTypeEmpty backboneUseFungal grobacterium transformation plasmid, testeā¦Available SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only