We narrowed to 10,269 results for: tre promoter
-
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPINF AtMKK5
Plasmid#228396PurposeRecombinant expression of His6-tagged Arabidopsis thaliana MKK5 in E. coliDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS405 VAC8-G2A,C4A,C5A,C7A-RFP
Plasmid#166842PurposeExpresses a myristoylation and palmitoylation mutant Vac8-RFP in yeasts, mutations are Gly2Ala, Cys4Ala, Cys5Ala, Cys7AlaDepositorInsertVAC8 (VAC8 Budding Yeast)
TagsRFPExpressionYeastMutationG2A, C4A, C5A, C7APromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 VAC8-G2A,C4A,C5A,C7A-GFP
Plasmid#166839PurposeExpresses a myristoylation and palmitoylation mutant Vac8-GFP in yeasts, mutations are Gly2Ala, Cys4Ala, Cys5Ala, Cys7AlaDepositorInsertVAC8 (VAC8 Budding Yeast)
TagsGFPExpressionYeastMutationG2A, C4A, C5A, C7APromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pREMI-ZA
Plasmid#183736PurposePlasmid for a restriction enzyme mediated integration (REMI) in Komagataella phaffiiDepositorInsertSh ble
UseRandom insertional gene deletion in komagataella …PromoterTEF1 promoterAvailable SinceMarch 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG415GPD-EGFP
Plasmid#166137PurposeEGFP expression under the control of the GPD promoter yeastDepositorInsertEGFP
ExpressionYeastPromoterGDPAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG415GPD-mRuby3
Plasmid#166138PurposemRuby3 expression under control of the GPD promoter in yeastDepositorInsertmRuby3
ExpressionYeastPromoterGDPAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF16_P2A_Hygro_Barcode
Plasmid#120502PurposeBarcoded lentiviral vector to express KLF16 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
LV-hGFAP-SOX2
Plasmid#183907PurposeExpression of human SOX2 under the human GFAP ABC1D promoterDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET PD-1/SHP2 Bidirectional Vector
Plasmid#237016PurposeExpress NanoLuc(R)-PD1/SHP2-HaloTag Fusion Proteins in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBiex-1 AC30_eGFP
Plasmid#82715PurposeExpresses a GFP-tagged recombinant adenylyl cyclase.DepositorTagsFLAG purification tag and eGFPExpressionBacterial and InsectPromoterT7 PromoterAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET BiBRET Vector, NanoLuc-HRAS WT-CRAF RBD-HaloTag
Plasmid#236861PurposeExpress NanoLuc(R)-HRAS WT-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector, NanoLuc-NRAS (Q61K)-CRAF RBD-HaloTag
Plasmid#236860PurposeExpress NanoLuc(R)-NRAS (Q61K)-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61KPromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoLuc-NRAS (Q61R)-CRAF RBD-HaloTag BiBRET Vector
Plasmid#236862PurposeExpress NanoLuc(R)-NRAS (Q61R)-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61RPromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector HaloTag-NRAS WT-BRAF RBD-NanoLuc
Plasmid#236851PurposeExpress HaloTag(R)-NRAS WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
BiBRET Vector HaloTag-NRAS (Q61R)-BRAF RBD-NanoLuc
Plasmid#236852PurposeExpress HaloTag(R)-NRAS (Q61R)-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61RPromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML107
Plasmid#67639PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3 (aka GAP promoter)Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET BiBRET Vector HaloTag-HRAS WT-BRAF RBD-NanoLuc
Plasmid#236850PurposeExpress HaloTag(R)-HRAS WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
BCR/ABL P190 transgenic construct
Plasmid#38185DepositorUseConstruct for making transgenic micePromotertruncated mouse MT promoterAvailable SinceOct. 26, 2012AvailabilityAcademic Institutions and Nonprofits only