We narrowed to 28,145 results for: STI;
-
Plasmid#127276PurposeExpresses human ELL2 with M133, 138, 186ILeu to prevent internal Met initiation peptides and contains middle HA tag that doesn't disrupt functionDepositorInsertELL2 (ELL2 Human)
ExpressionMammalianMutationM133, 138, 186 to Ileu, HA tag at XbaI after Met …PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-FX
Plasmid#111272Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20-amino-acid linker (GGS)3GS(GGS)3, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20aa linker (Syk Mouse)
ExpressionBacterialMutationinterdomain A (Phe 119 to His 162) substituted by…PromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-M-MLV(WT) (DRR1012)
Plasmid#217799PurposeVariant CE1 construct with wild-type M-MLV revese transcriptase (RT), expressed from CMV or T7 promotersDepositorInsertPCV2-XTEN-nSpCas9-BPNLS-M-MLV-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-bpNLS-Stab-exin21-Bxb1(A315R)-Stab (CJT605)
Plasmid#248211PurposebpNLS-, stabilon-, and exin21-tagged Bxb1 (A315R) recombinase, expressed from a CMV promoter.DepositorInsertbpNLS-Stab-exin21-Bxb1(A315R)-Stab
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationBxb1(A315R)PromoterCMV and T7Available SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pERM2-nhpSer
Plasmid#201922PurposeEnables translational incorporation of non-hydrolyzable phosphoserine into proteins at TAG codons in E coli. Do not use for phosphoserine incorporation.DepositorInsertsSepRS(2)
Sep-tRNA v2.0
SerB
EF-Sep
TagsNoneExpressionBacterialMutationE412P, E414F, T417K, P495M, I496W, F529S and H67R…PromoterGlnS (constitutive), OXB20 (constitutive), lpp (c…Available SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
TERT - WT
Plasmid#213827PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomeraseDepositorInserthuman TERT (TERT Human)
UseLentiviralExpressionMammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
TERT - R865C
Plasmid#213926PurposeExpresses Mutant TERT R865CDepositorInsertMutant TERT R865C (TERT Human)
UseLentiviralTags6x His TagExpressionMammalianMutationArginine 865 changed to CysteinePromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL2 IRES miRFP720-P2A-Blast
Plasmid#248031PurposeConstitutively expresses myc tagged membrane bound IL2, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL2 (IL2 Human)
UseLentiviralExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only