We narrowed to 7,863 results for: tet on
-
-
IBMc326
Plasmid#161949PurposeContains Type IIS restriction site free elements for expression vectors in IBM. Expression vector to generate ORF insertion library in IBM on ECF20DepositorInsertpSB3T5(BsaI-)-PBAD(SapI-)-B33-ECF20(1-5)-BsaI-BsaI-ECF20(187-193)-Ter
ExpressionBacterialPromoterPBADAvailable SinceMarch 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9GG
Plasmid#131009PurposeBackbone plasmid for generating CRISPR arrays for SpCas9 using CRATES. Contains a direct repeat and a RFP-dropout cassette.DepositorInsertsdirect repeat of SpCas9
promoter PJ23119
mRFP expression cassette
UseCRISPRExpressionBacterialPromoterBba_R0040 TetRAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFAB1935
Plasmid#47860PurposeBIOFAB reporter plasmid for measuring his_T_min_linker_crp_T_min termination efficiencyDepositorInserthis_T_min_linker_crp_T_min double terminator
UseSynthetic BiologyExpressionBacterialMutationconcatenate of his_min and crp_minPromoterpLTetO15Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/SH/GW-Mst1
Plasmid#84299PurposeExpresses a tetracycline-inducible SH-tagged (streptavidin-binding peptide and HA tag) version of Mst1. Used in conjunction with Flp-In cells to generate single copy transgene.DepositorAvailable SinceOct. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFs57aED-GCN4-sfGFP-ST
Plasmid#175018PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEF s57a ED
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutations57a esterase knock out mutantPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKF-P14MMP2AG-T2APuroR-5h
Plasmid#128256PurposeMammalian positive feedback gene circuit in a Flp-In expression system controlling the PuroR gene. Also called mPF-PuroR.DepositorInsertrtTA-Advanced::P2A::EGFP::T2A::PuroR
UseSynthetic Biology; Flp-in expression vectorExpressionMammalianPromotertight TRE promoterAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
JPF0419v
Plasmid#124021PurposeEncodes pCAG driving expression of multicistronic Lyn-tagged iRFP713, cytoplasmic mAzamiGreen, mCerulean-tethered p38 KTR, and Histone 2B fused to mScarlet in a PiggyBac destination vectorDepositorInsertPB_pCAG-Lyn-iRFP713_pCAG-NES-mAzamiGreen_pCAG-p38KTR-mCerulean_pCAG-H2B::mScarlet
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT3-RhoAC
Plasmid#100032PurposeThis plasmid is for expression of a rhodopsin/guanylyl cyclase fusion protein mutant with adenylyl cyclase activity.DepositorInsertRhoAC
Tags1D4 (TETSQVAPA)ExpressionMammalianMutationE497K/C566DPromoterAdenovirus major late promoterAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9noSsrA
Plasmid#102285PurposeModified from pCas9-CR4 (Addgene: 62655) to remove the ssrA tag from Cas9.DepositorInsertCas9
UseCRISPRExpressionBacterialMutationremoved ssrA tagPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT3-RhoGC E254D
Plasmid#100033PurposeThis plasmid is for expression of a rhodopsin/guanylyl cyclase fusion protein mutant with lambda max = 390 nm.DepositorInsertRhoGC E254D
Tags1D4 (TETSQVAPA)ExpressionMammalianMutationE254DPromoterAdenovirus major late promoterAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFAB1902
Plasmid#47858PurposeBIOFAB reporter plasmid for measuring M13_central_T_linker_rrnD_T1 termination efficiencyDepositorInsertM13_central_T_linker_rrnD_T1 double terminator
UseSynthetic BiologyExpressionBacterialMutationconcatenate of M13 central and rrnDPromoterpLTetO13Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-CsALSgR1.1
Plasmid#245877PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.1
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-TLS-CsALSgR1.2
Plasmid#245878PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-PtALSgRNA
Plasmid#245881PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS gene along with TLS mobile RNA sequenceDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-CsALSgR1.1
Plasmid#245875PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALS_gRNA1.1
UseCRISPR; Golden gate entry vector to expressing t…ExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-CsALSgR1.2
Plasmid#245876PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-MS2-RecT-dCas9-BSD
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIFR-5
Plasmid#233294PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette used for selecting for the integration can be removed in a later stage with pFNC.DepositorInsertmsfGFP
Promoterp14G-BCD2Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only
