We narrowed to 43,182 results for: gats
-
Plasmid#114180PurposeORAI1 channel with C-terminal YFP, carrying the mutation V107M in the protein 1st transmembrane domain, responsible for a constitutive activity and associated with tubular aggregate myopathy (TAM).DepositorAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pVITRO1-102.1F10-IgG2/λ
Plasmid#50367PurposeExpresses grass pollen allergen Phl p 7 specific human IgG2/λ antibody isotype (102.1F10-IgG2/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 2 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
TFORF3084
Plasmid#144560PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgG3/λ
Plasmid#50368PurposeExpresses grass pollen allergen Phl p 7 specific human IgG3/λ antibody isotype (102.1F10-IgG3/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 3 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
TFORF2972
Plasmid#144448PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF3510
Plasmid#144986PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3020
Plasmid#144496PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
UQCRB_pLX307
Plasmid#98381PurposeLentiviral expression of UQCRBDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF3445
Plasmid#144921PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3314
Plasmid#144790PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONOR223 R2pH-LAMP1-3xFLAG
Plasmid#157941Purposegateway donor vector encoding ratiometric sensor of lysosomal lumenal pHDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF3528
Plasmid#145004PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
EMR2_pLX307
Plasmid#98332PurposeLentiviral expression of EMR2DepositorAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF3463
Plasmid#144939PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_SOX2
Plasmid#45270DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
TFORF3304
Plasmid#144780PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3231
Plasmid#144707PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2-FUS-1-413aa-V5
Plasmid#29612DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only