We narrowed to 9,273 results for: sgRNA
-
Plasmid#86127PurposeLentiviral vector expressing Cas9 and an sgRNA targeting PREX1DepositorAvailable sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLV/Guide-mCherry
Plasmid#170543PurposeExpresses mCherry and contains a cassette for U6 driven sgRNA transcriptionDepositorInsertmCherry
UseCRISPR and LentiviralPromoterEf1-alphaAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE_KKH C-terminal
Plasmid#137184PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE, and U6-sgRNA (KKH variant).DepositorInsertv5 AAV-saCBE_KKH C-terminal
UseAAVMutationE782K;N968K;R1015H conferring recognition of NNNRā¦PromoterCbhAvailable sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330.orup
Plasmid#110404PurposeCRISPR/Cas9 vector with sgRNA expression and puromycin resistanceDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBhAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Mitochondria, Trafficking, and Motility (h4), top 5 sgRNAs/gene
Pooled library#83983PurposeHuman CRISPRa Pooled Library targeting Mitochondria, Trafficking, and Motility genesDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoterā¦Available sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV312.3
Plasmid#119944PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cellsDepositorInsertC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable sinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
qTAG-N-Solo-mStayGold-ACTB
Plasmid#227326PurposeDonor template for mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorInsertACTB Homology Arms flanking a mStayGold Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
Plasmid#222992PurposeMammalian expression of iNme2Cas9 construct with EGFP-targeting sgRNADepositorInsertHuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
UseCRISPRTagsPuroExpressionMammalianPromoterpCAGAvailable sinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targetiā¦PromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN022
Plasmid#91668PurposeExpress sgRNA targeting human SHANK3DepositorAvailable sinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN217
Plasmid#91676PurposeExpress sgRNA targeting human TLE1DepositorAvailable sinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 PLIN2
Plasmid#202196PurposepX330 backbone expressing sgRNA to edit the C-terminus of human PLIN2DepositorAvailable sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationCterm_Nterm_switchedAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
epi-ABEmax
Plasmid#135974PurposeExpresses ABEmax, EBNA1 and blasticidin resistence gene; cloning backbone for sgRNA; Contains Epstein-Barr virus oriP replication originDepositorTypeEmpty backboneExpressionMammalianAvailable sinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only