We narrowed to 14,412 results for: sgRNA
-
Plasmid#115519PurposeTo construct multiple sgRNA expression vector for CRISPRDepositorInsertccdB-sgRNA scaffold
UseCRISPRAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
psgRNAc
Plasmid#114006Purposeexpress sgRNA, p15A, CRMDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-MS2-PP7
Plasmid#75392PurposesgRNA1-MS2-PP7DepositorInsertsgRNA1-2XMS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAN-AND
Plasmid#62308Purposesynthetic circuit: AND gateDepositorInsertsA1NT sgRNA
A4NT sgRNA
A2NT sgRNA
A1NT
UseCRISPRExpressionBacterialPromoterPA2, PPhlF, pA4, and pBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC523
Plasmid#62320PurposesgRNA for yeast cellsDepositorInsertsgRNA
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJR107
Plasmid#187245PurposeLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-GFP marker expressionDepositorInsertLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter
UseLentiviralAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-boxB-MS2-PP7
Plasmid#75397PurposesgRNA1-boxB-MS2-PP7DepositorInsertsgRNA1-boxB-MS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with U6 promoter
Plasmid#48962Purposeto drive the sgRNA expression under a U6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLG_GI2
Plasmid#111593PurposemU6-sgRNA GI Library vectorDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA-Target1 (MpRTN1)
Plasmid#186291PurposeGateway entry vector for sgRNA (target 1: MpRTN1). Transient expression of sgRNA (Target 1: MpRTN1) for MpRTN1 in plant cellsDepositorInsertsgRNA-Target1
UseCRISPRAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAN-NOR
Plasmid#62306Purposesynthetic circuit: NOR gateDepositorInsertsA2NT sgRNA
A2NT sgRNA
UseCRISPRExpressionBacterialPromoterPPhlF and pBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJR106
Plasmid#187244PurposeLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter
UseLentiviralAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA- Pconstitutive-sgRNA(Sth3)_cpaA
Plasmid#133348Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets blaA and second one targets cpaA (from Caulobacter crescentus)DepositorInsertsgRNA_blaA and sgRNA_cpaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPRainbow Kit for Multiplex Labeling
Plasmid Kit#1000000079PurposePlasmids using dCas9 and gRNA scaffolds that bind fluorescent proteins to label multiple chromosomal loci.DepositorApplicationGenome EditingVector TypeLentiviral, Mammalian ExpressionEditing TypeCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRAvailable SinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits