We narrowed to 32,659 results for: LIS;
-
Plasmid#111602PurposeExpress human LRRC33 in 293T cellsDepositorAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
GFP-nArgBP2ΔNSE
Plasmid#74515PurposeExpress GFP-nArgBP2ΔNSE fusion protein in mammalian cells. nArgBP2ΔNSE is the mutant without the neuronal specific exon of nArgBP2.DepositorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-MUTED
Plasmid#164629PurposeExpresses MUTED in mammalian cells with a GFP tagDepositorAvailable SinceJune 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-OB-Linker-eGFP
Plasmid#176068PurposeEGFP fused to the C-terminus of an OB domain & a hygromycin resistance cassetteDepositorInsertOB
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSin-GFP-Fg
Plasmid#174307PurposeLentiviral expression of GFPDepositorAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 6B CARD8 UPA-CARD-mCherry R464E
Plasmid#164013PurposeMammalian expression vector encoding CARD8 UPA-CARD (filament-deficient mutation) with a C-terminal mCherry tag for imagingDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR mitfa:KIT L576P
Plasmid#118848PurposeExpresses human KIT L576P mutant and zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-iGECI
Plasmid#160423PurposeAAV plasmid for CaMKII-driven expression of a genetically-encoded calcium indicator iGECIDepositorInsertiGECI
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti_DCLK1 G533N
Plasmid#163627PurposeExpresses DCLK1 G533N in E. coliDepositorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-Rabin8
Plasmid#118070PurposeExpresses Flag-tagged human Rabin8 in mammalian cellsDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-4
Plasmid#228986PurposeFor bacterial expression of anti-GST nanobody GST-4, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-4
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaRIgG-2
Plasmid#228996PurposeFor bacterial expression of anti-rabbit IgG nanobody LaRIgG-2, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaRIgG-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-12
Plasmid#228999PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-12, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-12
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-3
Plasmid#228985PurposeFor bacterial expression of anti-GST nanobody GST-3, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-3
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDB.His.MBP.3C CARD8 CARD WT
Plasmid#164022PurposeBacterial expression vector encoding a HRV 3C-cleavable His-MBP-tagged CARD8 UPA-CARDDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3A-BE3-Y130F
Plasmid#113428PurposeExpresses hA3A-BE3-Y130F in mammalian cellsDepositorInserthA3A-BE3-Y130F (APOBEC3A S. pyogenes and Bacteriophage PBS2, Human)
UseCRISPRExpressionMammalianMutationhAPOBEC3A_Y130FPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-FLAG-mProser1-IRES-Blast
Plasmid#226172PurposeExpresses full length mouse PROSER1 with 2X N-terminal FLAG tagsDepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSW646 - pML1>>
Plasmid#115995Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpML1:B-dummy:GR-LhG4:D-dummy:tRBCS:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only