We narrowed to 9,135 results for: sgRNA
-
Pooled Library#92352PurposeFocused gRNA library that targets synthetic lethal candidate and control genes with oncogenic Ras.DepositorSpeciesHomo sapiensAvailable SinceJune 7, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pBHM2680
Plasmid#241725PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains BSR marker for selection on blasticidin SDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMR-A-3-Sasg
Plasmid#214349PurposeExpresses T7-RNAP, and cloning backbone for sgRNADepositorInsertT7-RNAP
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H2BC11
Plasmid#227330PurposeDonor template for mStayGold insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a mStayGold Tag (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MYO1C
Plasmid#227306PurposeDonor template for mStayGold insertion into the N-terminus of the MYO1C locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MYO1C (Addgene #227305)DepositorInsertMYO1C Homology Arms flanking a mStayGold Tag (MYO1C Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CEP135
Plasmid#227287PurposeDonor template for mStayGold insertion into the N-terminus of the CEP135 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CEP135 (Addgene #227286)DepositorInsertCEP135 Homology Arms flanking a mStayGold Tag (CEP135 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-PCNT
Plasmid#227285PurposeDonor template for mStayGold insertion into the N-terminus of the PCNT locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PCNT (Addgene #227284)DepositorInsertPCNT Homology Arms flanking a mStayGold Tag (PCNT Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-ultraID-LMNB1
Plasmid#207775PurposeDonor template for Blast-2A-ultraID insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-ultraID Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Solo-mScarlet-ACTB
Plasmid#207750PurposeDonor template for mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a mScarlet Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Solo-sTagRFP-TUBA1B
Plasmid#207765PurposeDonor template for sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a sTagRFP Tag (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Nsp2Cas9_AAV
Plasmid#192143PurposeExpresses Nsp2Cas9, and cloning backbone for sgRNADepositorInsertNsp2Cas9
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nsp2-SmuCas9_AAV
Plasmid#192144PurposeExpresses Nsp2-SmuCas9, and cloning backbone for sgRNADepositorInsertNsp2-SmuCas9
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E17A
Plasmid#157782PurposeExpresses a sgRNA targeting stop codon of human FMR1 geneDepositorAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E3B
Plasmid#157783PurposeExpresses a sgRNA targeting the 3rd exon of human FMR1 geneDepositorAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
API5-CRISPR
Plasmid#157664PurposeExpresses Cas9 and sgRNA targeting API5DepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF204
Plasmid#121656PurposeU6-sgRNA EFS-Cas9-wt-P2A-PuroDepositorInsertCas9
UseLentiviralPromoterU6Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only