We narrowed to 15,163 results for: GRN
-
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBBK02 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitKanR, AmpR)
Plasmid#178986PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK06 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitNatR,AmpR)
Plasmid#178990PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitNourseothrycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW188-lenti-spsgRNA-lacZ-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170813PurposeLentiviral vector to co-express a lacZ control spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseGateway Cloning and Synthetic BiologyPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
1073A(HomeR1)=pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159676PurposePlasmid provides the HomeR#1 gene drive element harboring a rescue, gRNA#1, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #1 via HDR.DepositorInsertpBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
ExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA_NUDT5_ex4-EF1α-Cas9-NLS-FLAG-GSG-P2A-PuroR-WPRE
Plasmid#250374PurposeLentiviral expression of sgRNA against human NUDT5 exon 4 under U6 promoter and Cas9-NLS-FLAG-GSG-P2A-PuroR under EF1α core promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-Non-target sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196989PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with non-target sgRNADepositorInsertNon-Target
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK2046-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223166Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 3- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210739PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 3DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 1- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 2- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210738PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 2DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 4- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210740PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 4DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only