-
Plasmid#67339PurposehArl14 without stop codon in Gateway Entry vectorDepositorInsertARL14 (ARL14 Human)
UseGateway entry vectorTagsExpressionBacterialMutationbp 172 C to T; aa L58FPromoterNoneAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARFRP1
Plasmid#67342PurposehArfrp1 with stop codon in Gateway Entry vectorDepositorInsertARFRP1 (ARFRP1 Human)
UseGateway entry vectorTagsExpressionBacterialMutationPromoterNoneAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARF1-no stop
Plasmid#67307PurposehArf1 without stop codon in Gateway Entry vectorDepositorInsertARF1 (ARF1 Human)
UseGateway entry vectorTagsExpressionBacterialMutationPromoterNoneAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARF3-no stop
Plasmid#67309PurposehArf3 without stop codon in Gateway Entry vectorDepositorInsertARF3 (ARF3 Human)
UseGateway entry vectorTagsExpressionBacterialMutationPromoterAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARF6-no stop
Plasmid#67315PurposehArf6 without stop codon in Gateway Entry vectorDepositorInsertARF6 (ARF6 Human)
UseGateway entry vectorTagsExpressionBacterialMutationPromoterNoneAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160E,NoCys)
Plasmid#66875PurposeExpresses a cysteine-free version of pET30Xa-SBL1(160E) (4Cys to Ser) with N-term HistagDepositorInsertsoybean lipoxygenase-1 (S160E) with all Cys to Ser mutations
UseTagsHistagExpressionBacterialMutationS160E; changed 4 (all) cysteines to serinePromoterT7lacAvailable sinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to bulged siRNA
Plasmid#40765PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to bulged target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed siRNA
Plasmid#40766PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed plus 13-16 siRNA
Plasmid#40767PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed plus 13-16 target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Gb2-K
Plasmid#25759PurposeEntry vector with human U6 promoter driving both mouse G alpha 12 and G alpha 13 miR30-based shRNAs.DepositorInsertGb2 miR-shRNA (Gnb2 Mouse)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAC1-V16-hGDNF
Plasmid#122035PurposeAAV vector, pTet bidi (bidirectional tetracycline-responsive promoter) driving Tet-dependent rtTA and hGDNF expressionDepositorInserthGDNF (GDNF Human)
UseAAVTagsExpressionMutationPromoterAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR8 JARID2
Plasmid#114443PurposeEntry vector for gateway cloning containing human JARID2 coding sequenceDepositorInsertJARID2 (JARID2 Human)
UseGateway entry cloningTagsExpressionMutationPromoterNoneAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
tetO-ASCL1-LMX1b-NURR1-PuroR
Plasmid#182298PurposeDoxycycline-inducible vector expressing the ALN transcription factors and PuroR (all separated by 2A sequences)DepositorUseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Ef1a-mClover-W377A/W428A YTHDC1-T2A-BSD-siRNA-Resistant
Plasmid#177130PurposeGenerate lentivirus to introduce mClover tagged m6A binding null mutant W377A/W428A YTHDC1DepositorInsertYTHDC1 (YTHDC1 Human)
UseLentiviralTagsmClover3ExpressionMutationW428A/W377A (m6A binding defects), and siRNA resi…PromoterEf1aAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR8 PALI1
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorInsertPALI1 (LCOR Human)
UseGateway entry cloningTagsExpressionMutationPromoterNoneAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only