We narrowed to 27,803 results for: gfp
-
Plasmid#83950PurposeRac1 FLIM donor for dynamic imaging of GTPase activityDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pEN_TTGmiRc2
Plasmid#25753PurposeEntry vector for cloning miR30-based shRNA driven by TRE-tight promoter with GFP coexpression.DepositorTypeEmpty backboneUseGateway CloningTagsGFPAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRoCascade_gfp
Plasmid#178771PurposeExpression of Rocas6, Rocas8, Rocas7, Rocas5, RoCAST CRISPR repeat, gfp from Rippkaea orientalisDepositorInsertRocas6, Rocas8, Rocas7, Rocas5, RoCAST CRISPR repeat, gfp from Rippkaea orientalis
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHW1176
Plasmid#229871Purposegene trap RMCE plasmid with GFP-C1-tbb-2 3'UTR::SEC for RMCE cloned in the destination vector pHW1133 to swap driver via RMCEDepositorInsertGFP-C1-tbb-2 3'UTR::SEC
TagsGFP-CExpressionWormAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
CT336
Plasmid#233662PurposeAND Gate Reporter to identify Cre and Flp recombination; FRT-STOP-FRT-loxP-STOP-loxP-GFPDepositorInsertFRT-STOP-FRT-loxP-STOP-loxP-GFP
ExpressionMammalianMutationNoneAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-GFP [N86/34R]
Plasmid#220419PurposeMammalian Expression Plasmid of anti-GFP (Jellyfish) IgG2a R-mAb. Derived from hybridoma N86/34DepositorInsertAnti-GFP (Aequorea victoria) recombinant mouse monoclonal antibody.
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRC54-DHX37-GFP
Plasmid#192149Purposeexpress DHX37-GFPDepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1E KI
Plasmid#131481PurposeEndogenous tagging of CaV2.3, R: N-terminal (amino acid position: G5)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET22b-mEB3-eGFP-6xHis
Plasmid#130983PurposeBacterial expression of mouse EB3-GFP-6xHis for protein purification.DepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35
Plasmid#247210PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-GFP 5' Half Only
Plasmid#69907PurposeExpresses a circular RNA containing the 5' half of GFP in mammalian cellsDepositorAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMMP-dnPERK-IRES-eGFP
Plasmid#36954DepositorInsertdnPERK (EIF2AK3 Human)
UseRetroviralExpressionMammalianMutationdeletion of aa592-1061 to create dominant negativePromoterCMVAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mito).cpSFGFP.HaloTag
Plasmid#214925PurposeExpresses mitochondrially targeted non-responsive controlDepositorInsert(mito).cpSFGFP.HaloTag
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-19:LAMP1-mEGFP
Plasmid#101782PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human LAMP1DepositorInsertLAMP1 Homology Arms with linker-mEGFP (LAMP1 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianAvailable SinceNov. 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIRES2-EGFP-SHP2DA
Plasmid#12286DepositorInsertSHP-2DA (PTPN11 Human)
TagsMycExpressionMammalianMutationAspartic Acid 425 mutated to AlanineAvailable SinceAug. 11, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSyn-PROGERIN
Plasmid#140189PurposeOverexpression of Progerin with a GFP fusion protein, under human synapsin promotorDepositorAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFR-mEGFP
Plasmid#203774PurposeNumber and brightness analysis of EGFR oligomerizationDepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV.CMVenh.gp91.eGFP.cHS4
Plasmid#30471DepositorInsertCMVenh/gp91/eGFP/cHS4
UseLentiviralAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only