We narrowed to 7,854 results for: alp
-
Plasmid#159686PurposeMammalian protein expression of NRAS HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/10R]
Plasmid#177528PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/10R.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTM-RBDv2
Plasmid#162785PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cellsDepositorInsertSARS-CoV-2 S protein receptor binding domain (RBD) (S Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
Tags10xHis, c-myc, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PHKA1
Plasmid#23471DepositorInsertPHKA1 (PHKA1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSNK1A1L
Plasmid#23784DepositorInsertCSNK1A1L (CSNK1A1L Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterUbcAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 human HAgHA-plus exon 18a - Short-Cterm - Arginine -in pcDNA3
Plasmid#198915PurposeN-terminal GFP tagged, exofacial HAgHA tag in Domain II, contains exon 18a, Short form of alternatively spliced C-teminus, SNP rs2278973 variant Arginine, in pcDNA3 vectorDepositorInsertCav2.2 (CACNA1B Human)
TagsN-terminal GFP, internal double HAExpressionMammalianMutationsnp rs2278973 ArgininePromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:CYP27B1_CE_pISceI
Plasmid#223028PurposeExpress CYP27B1 gene in mesenchymal lineage of Zebrafish.DepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_MmCavin1_EGFP
Plasmid#229689PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorUseLentiviralTagsEGFPPromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-KLF10-Brd 306
Plasmid#219240PurposeTranscription factor KLF10 with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3A_bGHpA
Plasmid#177355PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV(T9)-DERA-sgresis
Plasmid#222622PurposeLentiviral vector that expresses sgRNA resistant DERA in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
SHIP2-C1
Plasmid#214905Purposeexpression of the truncated variants of the SHIP2 that retains second proline-rich domain and C-terminal sterile alpha motifDepositorInserthuman SHIP2 aa 740-1258 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 1-739aaPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only