We narrowed to 8,392 results for: crispr grnas
-
Plasmid#250304PurposeEncodes gRNA targeting FUT3DepositorAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only
-
LentiGuideFUT5-neo
Plasmid#250305PurposeEncodes gRNA targeting FUT5DepositorAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiGuideFUT8-neo
Plasmid#250316PurposeEncodes gRNA targeting FUT8DepositorAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(CTRL)-hSyn-mCherry
Plasmid#231405PurposeCTRL knockdown gRNADepositorInsertsgRNA(CTRL)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-MYADM
Plasmid#235245PurposeEncodes gRNA for human MYADMDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-dsRed
Plasmid#217006Purposelentiviral plasmid for gRNA cloning with selectable dsRed expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML45
Plasmid#206995PurposeContains gRNA targeting mouse Ptbp1 gene and Cas9 ORF.DepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
1026L=U6-3-gRNA#1[Pol-γ35]
Plasmid#159674PurposePlasmid supports expression of gRNA targeting Pol-γ35 site #1, tagged with mini-White, and can be integrated with phC31.DepositorInsertU6-3-gRNA#1[Pol-γ35]
ExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
1026M=U6-3-gRNA#2[Pol-γ35]
Plasmid#159675PurposePlasmid supports expression of gRNA targeting Pol-γ35 site #2, tagged with mini-White, and can be integrated with phC31.DepositorInsertU6-3-gRNA#2[Pol-γ35]
UseCRISPRExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH50
Plasmid#128212Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK007
Plasmid#128220Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH72
Plasmid#128221Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH73
Plasmid#128222Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH74
Plasmid#128223Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.5Syn-CasRX-mCherry-pA
Plasmid#192489PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.5SynAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.4CaMKIIa-CasRX-mCherry-pA
Plasmid#192490PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.4CaMKIIaAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only