We narrowed to 27,236 results for: cat
-
Plasmid#223689PurposePhoBIT1 component; mCherry-tagged sspB with LOV2 insertionDepositorInsertsspB(N)-LOV2-sspB(C)
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-FKP-ET64
Plasmid#234665PurposeExpression an ELP-tagged FKP enzymeDepositorInsertfucokinase/GDP-fucose pyrophosphorylase
TagsELPExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-21_MBP-VidN
Plasmid#241013PurposeVidN construct that can be bacterially expressed, used to demonstrate intein splicing reaction.DepositorInsertMBP-VidN
TagsMBP-tagExpressionBacterialPromoterT7Available SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
P-Bf-fusA2
Plasmid#235658PurposeReports Cur activity in Bacteroides fragilisDepositorInsertBacteroides fragilis fusA2 promoter
MutationThe B. thetaiotaomicron fusA2 promoter lacking &q…Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-393)
Plasmid#236270PurposeBacterial expression of bovine arrestin-2 long isoform (1-393) Q394StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-382)
Plasmid#236269PurposeBacterial expression of bovine arrestin-2 long isoform (1-382) D383StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-8XHis-mCherry-Omp25
Plasmid#236399PurposeElutable MitoTag-AP systemDepositorInsert8XHis-mCherry-Omp25
UseRetroviralTags8XHis-tag and mCherryExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO361
Plasmid#235748PurposeProtein expression of ScVPS34 HELCATDepositorInsertVPS34 HELCAT
ExpressionYeastMutationaa 268-875Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 short
Plasmid#236267PurposeBacterial expression of bovine arrestin-2 short isoformDepositorAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-C-term K-R
Plasmid#233092PurposeExpression of GST-YihI with C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationC-term lysines (K) mutated to arginine (R)Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-S1BD
Plasmid#232580PurposeExpression of the Rnr S1 and basic domains (residues 1930 to 2442) as a GST-fusion.DepositorInsertRnr S1 + basic domain (residues 1930 to 2442)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-ND
Plasmid#232579PurposeExpression of the Rnr nuclease domain (residues 649 to 1929) as a GST-fusion.DepositorInsertRnr nuclease domain (residues 649 to 1929)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-CSD
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-L7-6-DD-T6B-WT-YFP
Plasmid#235145PurposeExpresses the inducible T6B peptide fused with DHFR and YFP under the Purkinje cell-specific L7-6 promoterDepositorInsertDHFR-fused T6B peptide
UseAAVPromoterL7-6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-L7-6-FLAG-HA-T6B-WT-YFP
Plasmid#235141PurposeExpresses the T6B peptide fused with YFP under the Purkinje cell-specific L7-6 promoterDepositorInsertT6B peptide
UseAAVTagsFLAG/HAPromoterL7-6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPYRMandi-ABI
Plasmid#233649PurposeCellular colocalization assay (PYRMandi/ABI) for the CIP Mandi (mandipropamid)DepositorInsertTOMM20-mCherry-PYRMandi-P2A-eGFP-ABI
ExpressionMammalianPromoterCMVAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only