We narrowed to 7,898 results for: chloramphenicol
-
Plasmid#53074Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pAG416GALL-ccdB-6stop
Plasmid#203511PurposeGateway-compatible destination vector for yeast expression with GALL promoter/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-ccdB-6stop
Plasmid#203512PurposeGateway-compatible destination vector for yeast expression with GAL10 promoter/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-c
Plasmid#53078Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-c
Plasmid#53070Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-c
Plasmid#53076Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-er-c
Plasmid#53068Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAM4663
Plasmid#85126PurposeNSIII -Cm-PkaiB-luc+ (firefly) vector constructed by seamless cloning with Cm casette codon optimized for S7942. PkaiB-luc+ amplified from pAM2105.DepositorInsertPkaiB-luciferase
ExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-c
Plasmid#53066Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-n
Plasmid#53069Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-n
Plasmid#53073Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-n
Plasmid#53077Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-n
Plasmid#53075Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-Hsp70-zCreI-mTagBFP2d-2xins (JDW 1002)
Plasmid#229817PurposeA gateway compatible Tol2 destination vector containing the Hsp70 promoter driving Cre and TagBFP followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only