We narrowed to 13,353 results for: BASE
-
Plasmid#101297PurposeFRET-based tension sensor (TS) technology to develop a probe for molecular-level tension across alphaE-catenin.DepositorInsertalpha-Catenin
ExpressionMammalianMutationContains amino acids 1-906 of alpha-CateninAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP mCherry-ApoB-EGFP
Plasmid#112859PurposePlasmid bearing the editing target of APOBEC1 fused between the mCherry cds and the EGFP one. In presence of APOBEC1, the CAA codon in ApoB is edited to a Stop codon (UAA), leading to loss of EGFPDepositorInsertmCherry-apoB-EGFP
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
RT3REVIR
Plasmid#111168PurposeTet-regulated miR-E (miR-30 variant)-based RNAiDepositorTypeEmpty backboneUseRetroviralTagsdsRed and mVenusPromoterT3GAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_pCMV-dCas-PmCDA1 pH1-gRNA(HPRT)
Plasmid#79621PurposeExpresses dCas9-PmCDA1 and gRNA(HPRT) in mammalian cellsDepositorInsertSpCas9
TagsPmCDA1ExpressionMammalianMutationD10A and H840A for nuclease deficient Cas9PromoterpCMVAvailable SinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35
Plasmid#247210PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
RT B2-B6-pUPD2
Plasmid#240719PurposeGUS:NPTII repair template used for HDR experiments with compatible reporter lines. Has B2-B6 Goldenbraid grammar.DepositorInsertRT
UseSynthetic BiologyAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
BCTVΔVSΔREP-RT-pDGB3alpha1
Plasmid#240727PurposeBCTV vector containing the GUS:NPTII repair template for HDR experiments. Lacks the BCTV virion sense ORFs and Rep has been mutated.DepositorInsertRT
ExpressionPlantMutation2 stop codons inserted in RepAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a spnull-3xFLAG-DR18 IRES mNeonGreen-P2A-Puro
Plasmid#248037PurposeConstitutively expresses 3xFLAG tagged DR18, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsert3xFLAG-tagged DR18
UseLentiviralTags3xFLAGExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a ACCx2 uORF eIL12 IRES mNeonGreen-P2A-Puro
Plasmid#248035PurposeConstitutively expresses an engineered version of IL12, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsertEngineered IL12
UseLentiviralExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdFLPtag-SA-SD-0-smGFP-HA
Plasmid#247945PurposeConditional tagging of endogenous proteins with smGFP-HA in open reading frame 0, with dual membrane labellingDepositorInsertsmGFP-HA
TagssmGFP-HAExpressionInsectAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdFLPtag-SA-SD-1-smGFP-HA
Plasmid#247946PurposeConditional tagging of endogenous proteins with smGFP-HA in open reading frame 1, with dual membrane labellingDepositorInsertsmGFP-HA
TagssmGFP-HAExpressionInsectAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdFLPtag-SA-SD-2-smGFP-HA
Plasmid#247948PurposeConditional tagging of endogenous proteins with smGFP-HA in open reading frame 2, with dual membrane labellingDepositorInsertsmGFP-HA
TagssmGFP-HAExpressionInsectAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdFLPtag-SA-SD-0-GFSTF
Plasmid#247949PurposeConditional tagging of endogenous proteins with GFSTF in open reading frame 0, with dual membrane labellingDepositorInsertGFSTF
TagsGFSTFExpressionInsectAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdFLPtag-SA-SD-1-GFSTF
Plasmid#247950PurposeConditional tagging of endogenous proteins with GFSTF in open reading frame 1, with dual membrane labellingDepositorInsertGFSTF
TagsGFSTFExpressionInsectAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdFLPtag-SA-SD-2-GFSTF
Plasmid#247951PurposeConditional tagging of endogenous proteins with GFSTF in open reading frame 2, with dual membrane labellingDepositorInsertGFSTF
TagsGFSTFExpressionInsectAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNB-Rep
Plasmid#238996PurposeNode B carrying the sfGPF reporter that can be used for the assembly of pEND-11Y, pEND-Y11, pEND-Z11 or pEND-ZYDepositorInsertsfGFP-MarAn10 downstream of a strong constitutive promoter and a binding site for sgRNA-1
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TrxA-(A AND C) OR T-SpyTag
Plasmid#246947PurposeExpresses multifunctional construct for (AND)OR-gated release of ThioredoxinA from materials in response to TEV OR (sortase eSrtA(2A9) AND HRV-3C) treatment. Contains a SpyTag for material tethering.DepositorInsertPlease see depositor comments below
Tags6x His tagExpressionBacterialAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only