We narrowed to 18,241 results for: multi
-
Plasmid#115652PurposerAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassetteDepositorUseAAVTagsBirA* and T2AMutationHomology region 1 and Homology region 2Available sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
HisGb1-STAT1(710-750) + CBP TAZ2 (1764-1855)
Plasmid#99342PurposeBacterial expression of mouse CBP TAZ2 domain by coexpression with HisGB1 tagged STAT1 TADDepositorAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-NCBD + ACTR
Plasmid#99335PurposeBacterial coexpression of CBP NCBD and NCoA3 binding domainsDepositorExpressionBacterialPromoterT7Available sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFIN-XOPS-tdTOM-MOPS-GFP
Plasmid#44347DepositorInsertsXOPS-tdTOM
MOPS-GFP
UseLentiviralPromoterXenopus Opsin (XOPS) (pos 3131-4495) and mouse op…Available sinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1Tt
Plasmid#44509DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-{CMV-CuO}>{PAX3::FOXO1}:T2A:mCherry
Plasmid#236629PurposePuromycin selected lentiviral construct with cumate-inducible PAX3::FOXO1DepositorUseLentiviralExpressionMammalianPromoterCMV-CuOAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUpstream2Lox
Plasmid#164573PurposeIntegration of 2 LoxN sites in the genome of P. bergheiDepositorInsertsUseCre/LoxPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGE-attB-GMR_mNeonGreen::3XFLAG::dCrk
Plasmid#131143PurposeRescue construct for targeting into crk[ΔattP]. Contains 110bp upstream of transcription start site, mNeonGreen, 3XFLAG, and dCrk cDNA, 3' UTR and 99bp downstream.DepositorInsertmNeonGreen::3XFLAG::Crk (Crk Fly)
UseCre/Lox; Attb recombination siteTags3XFLAG and mNeonGreenExpressionInsectAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFIN-RK-GFP-mIRBP156-CHER-WPRE
Plasmid#44351DepositorInsertsRK-GFP
mIRBP156-CHER
UseLentiviralPromoterhuman rhodopsin kinase (pos 2554-2850) and mouse …Available sinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFIN-mIRBP156-CHER-RK-GFP-WPRE
Plasmid#44593DepositorInsertsIRBP156-CHER
RK-GFP
UseLentiviralPromoterhuman rhodopsin kinase (pos 3723-4019) and murine…Available sinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCA-T-intron(Neo)-G(LNL)
Plasmid#36908DepositorInsertsT (i.e., ATG, start codon as a first exon)
GFP
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides before nucleotide 275 and ins…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAVS1_TREtight-GEM7-Halo-FRB-IRES-FKBP-SNAP-GFPNb_EF1a-rtTA3-T2A-Puro-P2A-Thy1.1
Plasmid#197063PurposeDonor plasmid for human AAVS1 locus knock-in, doxycycline-inducible expression of GEM7-Halo-FRB and Adaptor Protein (FKBP-SNAP-vhhGFP4)DepositorInsertsEncapsulin
Adaptor Protein
UseCRISPRTagsFRB and HaloTagExpressionMammalianMutationCodon-optimised for human cell expressionAvailable sinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCYC1pr-GNSI (LEU)
Plasmid#111450PurposeGNSI is a synthetic, genetically-encoded reporter that allows rapid plate-based assessment of AP-3 functional deficiency, using either colorimetric or growth phenotype readouts.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
TagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …Available sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTET-IUPi
Plasmid#122019PurposeExpresses IUP pathway genes (ChK, IPK, idi) under inducible promoter. aTC inducible. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpTETAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Myog'-2A-mCherryNLS-PGK-Purodtk
Plasmid#69547PurposeDonor vector for homologous recombination to insert a 2A-mCherry-NLS cassette in place of the stop codon of myogenin in the mouse genome.DepositorInsertsUseMouse TargetingTags2x nuclear localization signal and PVT1-2A "…MutationSilent V205V mutation in myogenin gene to prevent…Available sinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable sinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTH732-2µ-RLuc/staCFLuc
Plasmid#40607DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only