We narrowed to 12,154 results for: NSI
-
Plasmid#182488PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence (AG4TGGA)2 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free (PT)4P
Plasmid#182490PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence PTPTPTPTP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSmChnERT(#99)
Plasmid#184063Purposecyclofen-inducible mCherry nuclear relocation via mammalian cell transfection or mRNA synthesisDepositorInsertmCherry-nls-ERT2
UseSynthetic BiologyExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcA
Plasmid#184655PurposeRetroviral expression of mouse EPC1 delta EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationepc1 delta EPcAPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22iU66CriT(#387)
Plasmid#184061Purposecyclofen-inducible CRE activation in zebrafish permanent transgenicDepositorInsertCRE-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag.Mm.Epc1-EPcA
Plasmid#184657PurposeRetroviral expression of mouse Epc1 EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1-EPcAPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.DMAP1
Plasmid#184651PurposeRetroviral expression of mouse Dmap1DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcC
Plasmid#184656PurposeRetroviral expression of mouse EPC1 delta EPcCDepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1 delta EPCc.QTPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR2
Plasmid#176248PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR1
Plasmid#176247PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR3
Plasmid#176246PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only