We narrowed to 4,533 results for: Gaa
-
Plasmid#254426PurposeMammalian expression plasmid encoding an shRNA targeting tRNA-Phe(GAA).DepositorInserttRNA-Phe (anticodon GAA) 1-4
UseLentiviralPromoterU6Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shtRNA-Phe(GAA)-2
Plasmid#254427PurposeMammalian expression plasmid encoding an shRNA targeting tRNA-Phe(GAA).DepositorInserttRNA-Phe (anticodon GAA) 1-4
UseLentiviralPromoterU6Available SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgAAVS1_145
Plasmid#213170PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgAAVS1_118
Plasmid#213171PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgAAVS1_118 (AAVS1 Human)
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-F1-GTG-F2-GGT-F3-GAA
Plasmid#30707DepositorInsertF1 GTG, F2 GGT, F3 GAA
UseMrna productionTagsHAAvailable SinceNov. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
23SrRNA.RAV12(wt).2508-2580.GAAAC.duplexH90
Plasmid#26192DepositorInsert23S ribosomal RNA fragment (modified) with duplex H90
ExpressionBacterialMutationfragment 2508-2580 of E. coli rRNA, with nucleoti…Available SinceDec. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
23SrRNA.RAV12(wt).2508-2580.GAAAC.G2553U
Plasmid#26191DepositorInsert23S ribosomal RNA fragment (modified) with G2553U mutation
ExpressionBacterialMutationfragment 2508-2580 of E. coli rRNA, with nucleoti…Available SinceOct. 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
pKSB-618 U6-sgRNA2/3 GGAA AACA
Plasmid#173674PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB-609 U6-sgRNA1 ATCC GGAA
Plasmid#173671PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB-610 U6-sgRNA2 GGAA AGAG
Plasmid#173672PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-deltaU6-tRNA-Phe(GAA) 1-4
Plasmid#254428PurposeMammalian expression plasmid encoding human tRNA-Phe(GAA) isodecoder 1-4.DepositorInserttRNA-Phe (anticodon GAA) 1-4
UseLentiviralAvailable SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b ITGA2-tail-YPet (GFFKR/GAAKR)
Plasmid#145144PurposeShuttle vector with YPet-tagged ITGA2 cytoplasmic tail as an insert with a GFFKR/GAAKR mutationDepositorInsertITGA2-tail-YPet (GFFKR/GAAKR) (ITGA2 Human)
UseGateway CloningAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3- sgAAVS1.5-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216246PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and a highly efficient sgAAVS1.5 for AAVS1 integrationDepositorInsertCas9 and sgAAVS1.5
UseCRISPR; Human safe harbor locus (a avs1) site-spe…ExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (AAV8)
Viral Prep#154867-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (#154867). In addition to the viral particles, you will also receive purified pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA plasmid DNA. Syn-driven, Flp-dependent hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHuman Synapsin-1TagsmCherry (Flp-dependent)Available SinceAug. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (AAV Retrograde)
Viral Prep#154867-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA (#154867). In addition to the viral particles, you will also receive purified pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA plasmid DNA. Syn-driven, Flp-dependent hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHuman Synapsin-1TagsmCherry (Flp-dependent)Available SinceOct. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Wolfe-Lawson ZFN modular assembly kit
Plasmid Kit#1000000018PurposeEngineering zinc finger arrays by modular assembly.DepositorApplicationGenome EditingVector TypeZebrafish ExpressionEditing TypeZFNAvailable SinceNov. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
GL2 shRNA
Plasmid#86083PurposeA lentiviral construct for building stable cell lines expressing GL2 shRNA via puromycin selection.DepositorInsertcontrol shRNA
PromoterU6Available SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sf-U7snRNA-ESE-AS-NsiI
Plasmid#190694PurposeBasic vector used for the expression of U7-based antisense oligonucleotidesDepositorInsertU7 snRNA
UseLentiviralExpressionMammalianPromoterU7 promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-THAP11-rescue
Plasmid#37001DepositorInsertTHAP11 (THAP11 Human)
Tags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only