We narrowed to 658 results for: acr.2
-
Plasmid#140229PurposeDox-inducible expression of anti-Cpf1 AcrVA1. Constitutive EF1a driven rtTA and GFPDepositorInsertAntiCRISPR protein AcrVA1
UseLentiviralExpressionMammalianPromoterTRE3GAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC
Plasmid#114377Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C-linker-TlcnC, which targets GtACR2 to the somatodendritic compartment. Messier et al found this hybrid construct was the most effective at targetingDepositorInsertGtACR2-EYFP-Kv2.1C-linker-TlcnC (NEWENTRY )
UseAAVTagsEYFP and Kv2.1C-linker-TlcnCExpressionMammalianPromoterEf1aAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV1)
Viral Prep#83899-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV9)
Viral Prep#83899-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV Retrograde)
Viral Prep#83899-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBMTBX-2
Plasmid#26073DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBTBXh-2
Plasmid#26078DepositorTypeEmpty backboneTagsHisExpressionBacterialAvailable SinceNov. 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAW016-2
Plasmid#85613PurposeCas9-tracrRNA integration vector for Bacillus subtilisDepositorInsertcas9-tracrRNA
ExpressionBacterialAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pORTMAGE-2
Plasmid#72677PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Ap resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterpL promoterAvailable SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LVDP 2P.2
Plasmid#231904PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging firefly luciferase mRNA into the VLPsDepositorUseLentiviralMutationR203M in N proteinPromoterCMV, EF-1aAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-2
Plasmid#52378Purposeexpresses human Syndecan-1 GAGAL replaced with GADEV of SDC2 in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationGAGAL of syndecan-1 replaced with of GADED of SDC…PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
LVDP 2P.2.EGFP
Plasmid#231905PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging EGFP mRNA into the VLPsDepositorUseLentiviralMutationR203M in N proteinPromoterCMV, EF-1aAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2
Plasmid#83899PurposeGCaMP6f expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertGCaMP6f
UseAAVExpressionMammalianPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEY39
Plasmid#191043Purposeacr-2(2.1k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY61
Plasmid#191058Purposeacr-2(3.7k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G1 mutant
Plasmid#231913PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098 by implementing Asn-to-Gln mutationDepositorAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G12345 mutant
Plasmid#231920PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1134, N1158, N1173, N1194 by implementing Asn-to-Gln mutationDepositorInsertspike G12345 (S SARS-CoV-2)
TagsFLAGExpressionMammalianMutationN1098Q, N1134Q, N1158Q, N1173Q, N1194QPromoterCMVAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G13 mutant
Plasmid#231915PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1158 by implementing Asn-to-Gln mutationDepositorAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only