We narrowed to 864 results for: Anti-CRISPR
-
Plasmid#207489PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, CD19-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-858_CD19-BBz_CAR_TFAP4
Plasmid#207503PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, CD19-BBz_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-scFvGCN4sfGFPTET1CD
Plasmid#82561PurposeExpression vector for antibody-sfGFP-TET1CD.DepositorInsertscFvGCN4sfGFPTET1CD
ExpressionMammalianAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pACBE-FSR (pXK-1648)
Plasmid#208821PurposeUniversal Fluorescent Surrogate Reporter for adenine and cytosine base editors. Key Construct: CMV-mCherry-CMV-eGFP* (ATAACG)-hU6-gRNA.DepositorTypeEmpty backboneTagsEGFPExpressionMammalianPromoterCMV, U6Available SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-749_HA-GD2-28z_CAR_TFAP4
Plasmid#207490PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-852_HA-GD2-28z_TFAP4-HA
Plasmid#207502PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4-HA, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY092b-lenti-EFS-BCMA-BBz-T2APRODH2-T2APuro-WPRE
Plasmid#192193PurposeLenti-BCMA-CAR-PRODH2DepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY094-EFS-CD22-Blast-WPRE
Plasmid#192195PurposeLenti-CD22-OE-BlastDepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY096-RetroEFS-CD22BBz-WPRE
Plasmid#192197PurposeRetro-CD22CARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY088_AAV_EFS-BCMA-41BBz-PRODH2
Plasmid#192191PurposeBCMA CAR AAV vector PRODH2 KI (pLY088)DepositorInsertBCMA CAR AAV vector PRODH2 KI (pLY088) (TNFRSF17 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY097-RetroEFS-CD22BBz-PRODH2-WPRE
Plasmid#192198PurposeRetro-CD22CAR-PRODH2DepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-806_HA-GD2-28z_CAR_RFP-TFAP4
Plasmid#207493PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-851_HA-GD2-28z_HA-TFAP4
Plasmid#207501PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertHA-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTR-454 tNGFR-P2A-CARD11
Plasmid#186081PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY100-RetroEFS-HER2-28BBz-WPRE
Plasmid#192201PurposeRetro-HER2CARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-804_HA-GD2-28z_CAR_BATF-TFAP4
Plasmid#207491PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF-TFAP4, HA-GD2-28z_CAR (BATF Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-704_CD19-28z_CAR_tNGFR
Plasmid#207486PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttNGFR, CD19-28z_CAR (NGFR Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only