We narrowed to 13,668 results for: ache
-
Plasmid#106188PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVMutationGltI: S72APromoterCAGAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-EGFP-CLASP2 340-1084 9xS/A
Plasmid#24384DepositorInsertCLASP2 (340-1084) 9xS/A (CLASP2 Human)
TagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant. M…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLAP-MIS12-KARD
Plasmid#114057Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 p37 deltaUBX
Plasmid#113504PurposeBacterial expression of GST-tagged p37 lacking the UBX domainDepositorInsertp37 (Ubxn2b Mouse)
TagsGST-PreScission protease siteExpressionBacterialMutationdelta 251-331 (stop codon behind AA250)Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75234PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75235PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (2/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKK-mVenus-TEV
Plasmid#105774PurposeExpression of your protein of interest in fusion with yellow fluorescent protein at the N-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 11753368, 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsmVenus-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Neo-TmiR-Gb2
Plasmid#25744PurposeControl lentiviral vector with Tet-based inducible expression of mouse G beta 2 miR30-based shRNA, constitutive Neomycin resistance gene coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SP-cTAT-zsGreen-IRES-H2B-tdTomato
Plasmid#254722PurposeExpresses secreted, cell-penetrating form of zsGreen for niche labeling and expresses H2B-tdTomato as nuclear reporter.DepositorInsertSP-cTAT-zsGreen-IRES-H2B-tdTomato
ExpressionBacterial and MammalianPromoterPGKAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAJS1154 GFP
Plasmid#250748PurposeVector for lentiviral expression of GFP in iPSC-derived neurons. Control for pAJS1149DepositorInsertEmGFP
UseLentiviralPromoterCAGGAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAJS1085 pET His-Sumo-ORF
Plasmid#250758PurposeVector for bacterial expression of proteins with scarless SMNT3/Ulp1 cleavageDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-HK2-3xFLAG
Plasmid#239243PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains silent mutations introduced to ab…PromoterCMVAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-HK1-3xFLAG
Plasmid#239247PurposeHK1 lentiviral overexpression vectorDepositorInsertHK1 (HK1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the following silent mutations (c…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK2 (D209A, D657A)-3xFLAG
Plasmid#239251PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK1-3xFLAG
Plasmid#239252PurposeHK1 lentiviral overexpression vectorDepositorInsertHK1 (HK1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK2 (delta MBD)-3xFLAG
Plasmid#239254PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-MBD1-HK2-3xFLAG
Plasmid#239255PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only