We narrowed to 43,429 results for: Ina
-
Plasmid#166535PurposescFv of a human scaffold targeting Arginyl-tRNA synthetase. Antigen coverage aa 70-660 of 660DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-KARS-5
Plasmid#166530PurposescFv of a human scaffold targeting Lysyl-tRNA synthetase. Antigen coverage aa 1-597 of 597, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-DARS-1
Plasmid#166538PurposescFv of a human scaffold targeting Aspartyl-tRNA synthetase. Antigen coverage aa 1-501 of 501, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-LARS-15
Plasmid#166542PurposescFv of a human scaffold targeting Leucyl-tRNA synthetase. Antigen coverage aa 260-509 of 1176DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pR008_APAD
Plasmid#204818PurposeExpression Apobec1-ADAR2dd fusion protein as PIE-RBP controlDepositorInsertrat Apobec1 and human ADAR2 deaminase domain with engineered sites (Apobec1 Rat)
TagsHA and Flag and huADAR2ddExpressionMammalianPromoterchicken β-actin promoterAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
myc-POMP
Plasmid#86764PurposeN-terminal myc-tagged protein expression in mammalian cellsDepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-ErbB4CTF
Plasmid#17803DepositorInsertErbB4 (ERBB4 Human)
TagsHAExpressionMammalianMutationCarboxy-terminal fragment, amino acids 676-1292Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-STChRger2-TS-EYFP
Plasmid#129395PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by human Synapsin I promoter.DepositorInsertsoma targeted ChRger2
UseAAVTagsKv2.1-TS-EYFPExpressionMammalianPromoterhSynAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 LIC 6A CARD8-FLAG S297A
Plasmid#169949PurposeMammalian expression of CARD8-FLAG that is autoprocessing-deficient (S297A)DepositorAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDG-K341R
Plasmid#52267PurposeBacterial expression of mouse TDG-K341R with C-terminal GST-tagDepositorInsertTDG (Tdg Mouse)
TagsGSTExpressionBacterialMutationK341R, SUMO acceptor site mutationPromoterT7Available SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-Fc-His
Plasmid#72168PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-AP-His
Plasmid#72042PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + FlaAAA
Plasmid#84867PurposeBaculovirus Expression of LFn-FlaAAA fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
FlaAAA
UseBaculovirusTags6xHisExpressionInsectMutation3 C-terminal leucines have been replaced by alani…PromoterPolyhedrinAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP7-bio
Plasmid#47735PurposeExpresses enzymatically monobiotinylated full-length MSP7 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP7
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
HcRed-pcw107-V5
Plasmid#64647Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5PromoterPGKAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-AP-His
Plasmid#72021PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOCC175
Plasmid#118890Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal monomeric GFP, cleavable with TEVDepositorInsertNcoI-HIS6-MBP-3C-mGFP-TEV-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; mGFP, cleav…ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSP5-bio
Plasmid#47718PurposeExpresses enzymatically monobiotinylated full-length MSP5 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP5
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LAP2-beta-actin in modified pEGFP
Plasmid#34839DepositorAvailable SinceFeb. 1, 2012AvailabilityAcademic Institutions and Nonprofits only