We narrowed to 19,678 results for: cat
-
Plasmid#199275PurposepegRNA used to correct LMNA (c.1824C > T) mutationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNA 1824TtoC pegRNA
ExpressionMammalianAvailable sinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-T1
Plasmid#190825PurposeFor mammalian expression of T1, the RNA aptamer of ncOGT. Expression is driven by a U6 promoter.DepositorInsertT1 (an RNA aptamer of O-GlcNAc Transferase)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available sinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV U6-sgRNA UbC-GFP
Plasmid#106948PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with GFP markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
H2B-HT-emiRFP703
Plasmid#183985PurposeExpresses fluorescent HaloTag7 fusion protein in mammalian cells with nuclear localization.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2B (H2BC11 Human)
TagsHaloTag, emiRFP703ExpressionMammalianAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGIPz-PD-L1 3SA
Plasmid#121490PurposeExpression of human PD-L1 3SA with PD-L1 shRNADepositorInsertsPD-L1 3SA
humun PD-L1 shRNA
UseLentiviralTagsFlagExpressionMammalianMutationS176A, T180A, S184APromoterCMVAvailable sinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P POLE1_2
Plasmid#160764PurposeSuppress POLE1DepositorInsertshPOLE1_2
UseLentiviralAvailable sinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1P POLA1_2
Plasmid#160790PurposeSuppress POLA1DepositorInsertshPOLA1_2
UseLentiviralAvailable sinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DDX11_2
Plasmid#160778PurposeSuppress DDX11DepositorInsertshDDX11_2
UseLentiviralAvailable sinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD1_2
Plasmid#160774PurposeSuppress CISD1DepositorInsertshCISD1_2
UseLentiviralAvailable sinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAftsI
Plasmid#149590Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Avr2-GFP pZK538
Plasmid#118011Purposeexpresses Avr2-GFP (without signal peptide) and mCherry-HDEL. Used for visualization of cell-to-cell movement of Avr2. Avr2 can be replaced with gene of interest via HiFi DNA assembly cloning (NEB) .DepositorPublicationInsertsdspAvr2
mCherry
TagsEGFP and HDELExpressionBacterial and PlantPromoter35SAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-Tmem98-FLAG
Plasmid#124501PurposeExpresses FLAG-tagged mouse TMEM98 in mammalian cells (C-terminal tag)DepositorAvailable sinceMay 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSP64-AGS-mCherry
Plasmid#135596PurposeExpression of AGS-mCherry mRNA for microinjection for visualization of AGS protein dynamics in S. purpuratusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGS-mCherry
UseIn vitro transcription (mrna synthesis)TagsmCherryPromoterUnknownAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M2S_AmpR
Plasmid#119154PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with two mismatches in the seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with two mismatches in the seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
UR1Ct (265-1040)
Plasmid#115647Purposeexpression of truncated Rag1 including the RING, E3 ubiquitin ligase (265-1008) and C-terminal region (384-1040)DepositorInsertRag1 (265-1040) (Rag1 Mouse)
Tags8XHis-MBP-PreScissionExpressionMammalianMutationtruncated Rag1 (aa 265-1040)Available sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNAS1b split mCherry 14-3-3σ
Plasmid#111881PurposeMode #2 phosphosite expression (split mCherry, using 14-3-3σ binding domain)DepositorTypeEmpty backboneTagsSplit mCherry system: 14-3-3σ fused to C-terminal…ExpressionBacterialAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_2
Plasmid#106307PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Munc18cwt-pDEST27
Plasmid#85626PurposeGST tagged Munc18cDepositorAvailable sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only