We narrowed to 18,199 results for: erg
-
Plasmid#31217DepositorInsertSPAG5 (SPAG5 Human)
UseLentiviralExpressionMammalianMutationContains a one nucleotide deletion at C-term that…Available SinceAug. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-hSOX9-1
Plasmid#40644DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-HSF1
Plasmid#31210DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS1-hChR2-tBFP
Plasmid#178706PurposeAAV vector for transgene expression of hChR2-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInserthChR2-tBFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti.CMV/TO_PRKAA2
Plasmid#74447PurposeLentiviral expression vector encoding untagged WT human AMPK alpha 2DepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-FASCIN
Plasmid#31207DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Cdx2
Plasmid#70697PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Cdx2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Elf5
Plasmid#70772PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Elf5DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-MCM7
Plasmid#31212DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-HMGB1
Plasmid#31208DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Gata3
Plasmid#70270PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Gata3DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ascl2
Plasmid#71151PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ascl2/Mash2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ets2
Plasmid#70272PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4
Plasmid#170855PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5
Plasmid#170856PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-ANLN
Plasmid#31203DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GCaMP6f
Plasmid#178728PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only