We narrowed to 8,946 results for: gal
-
Plasmid#140131Purposecan be used to generate AAV virus that will express fusion protein of split Cre (N-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertNCreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEN6-Ubc5 Sc
Plasmid#83234PurposepHis-par2-UbHs/Ubc5Sc/ Uba1TaDepositorAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-EUI
Plasmid#111835PurposeEntry vector for adenoviral expression of Ecdysone receptor-based inducible transgene expression switch.DepositorAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ashL344P-mKate2-splitmVenusC
Plasmid#69587PurposeExpresses mutated p53-L344P tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-Lam
Plasmid#133899PurposeNegative control. Expression of Gal4BD-Lam hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV hGRN4
Plasmid#213684PurposeExpresses human granulin-4 with an N-terminal twin-Strep-FLAG tagDepositorInsertHuman granulin-4 (hGRN4) (GRN Human)
UseAAVTagsTwin-Strep tag and FLAG tag (after signal peptide…Promotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 Q280* K418* ectodomain
Plasmid#221399PurposeMammalian expression of human integrin beta1 Q280* K418* ectodomainDepositorInsertintegrin beta1 Q280* K418* ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK845
Plasmid#219746PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 codon-optimised for expression in Pichia pastoris, Homo sapiensDepositorInsertmutant of fungal luciferase
UseLuciferase and Synthetic BiologyMutationI3S, N4T, F11L, I63T, T99P, T192S, A199PAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* N562* ectodomain
Plasmid#221400PurposeMammalian expression of human integrin beta1 N391* N562* ectodomainDepositorInsertintegrin beta1 N391* N562* ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344A-mKate2-splitmVenusN
Plasmid#69584PurposeExpresses mutated p53-L344A tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426-Cup1p-FUS-FusionRed
Plasmid#188393PurposeCu2+-dependent expression of N-terminal FUS fused with red fluorescent protein in yeast cellsDepositorAvailable SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only