We narrowed to 16,204 results for: grna
-
Plasmid#192488PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42337PurposeDual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25H
Plasmid#91145PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgROSA26
Plasmid#231562PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human ROSA26 locus (Puromycin selection marker)DepositorInsertsgROSA26
UseCRISPR and LentiviralExpressionMammalianPromoterU6, EF-1aAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-BSD
Plasmid#216123PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the blasticidin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgEGFP
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
piggyFlex
Plasmid#218234PurposeA piggyBac transposon-based gRNA expression vector, to allow for genomic integration and stable expression of gRNAs. Contains both antibiotic (puromycin) and fluorophore (GFP) markers.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Actb KI #2
Plasmid#139666PurposeEndogenous tagging of β-actin: N-terminal (amino acid position: before startcodon)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE unc13a GFP KI
Plasmid#131498PurposeEndogenous tagging of Munc13-1: C-terminal (amino acid position: A1762)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV ORANGE Dlg4-HaloTag KI
Plasmid#139656PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:BRD:tNos (GB1172)
Plasmid#75401PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the BRD Transcriptional RepressorDepositorInsertdCas9:BRD
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-CLTC
Plasmid#227312PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of CLTC for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
BPK2101
Plasmid#65770PurposeBacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNADepositorInsertmammalian codon-optimized SaCas9, and SaCas9 gRNA
UseCRISPRTagsNLS-3xFlagExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Bsn-GFP KI
Plasmid#139665PurposeEndogenous tagging of Bassoon: C-terminal (amino acid position: F3938)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only