We narrowed to 1,092 results for: dTomato
-
Plasmid#22671DepositorInsertmyrtdTomato
ExpressionMammalianMutationGfa2 human GFAP promoterAvailable SinceJan. 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_dTomato_nlsdTomato (AAV1)
Viral Prep#218792-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_dTomato_nlsdTomato (#218792). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_dTomato_nlsdTomato plasmid DNA. Bicistronic expression of dTomato and nuclear-targeted dTomato under the control of the Lamp5 interneuron-targeting enhancer. These AAV preparations are suitable purity for injection into animals.DepositorTagsdTomatoAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ai62(TITL-tdT) Flp-in replacement vector
Plasmid#61576PurposeRecombinase-mediated cassette exchange in ES cells to insert a Cre & tTA-dependent tdTomato expression cassette into a docking site within the mouse TIGRE genomic locusDepositorInsertchromatin insulator flanked TRE-LSL-tdTomato
UseRecombinase-mediated cassette exchange using flp …Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT264
Plasmid#27438DepositorInsertTRE-tdTomato-myc flanked by insulators
UseMouse Targeting; Tta dependentTagsMycAvailable SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iT
Plasmid#27361DepositorInsertU6 promoter, SFFV promoter, IRES-tdTomato
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT268_(pCA-ATG-intron-tTA2-iiTRE-tdT3Mycii)
Plasmid#36880DepositorInsertstTA2
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pME-BrainbowTEC
Plasmid#82405PurposeGateway-compatible Brainbow-1.0 with fluorophores tdTomato-myc/EGFP/E2Crimson-HADepositorInsertstdTomatoMYC fusion
EGFP
E2CrimsonHA
TagsHA and MYCAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Fireworks RFP[PTC-] (AVA2515)
Plasmid#85443PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
eMscL G22S
Plasmid#107455PurposeeMscL G22S is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianMutationBearing a glycine to serine substitution at posit…Promoterhuman synapsin 1Available SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1955
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ai66(RCRL-tdT) targeting vector
Plasmid#61578PurposeTarget a Dre and Cre-dependent tdTomato expression cassette to the mouse Rosa26 locusDepositorInsertCAG-RSR-LSL-tdTomato
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW yAT1.03
Plasmid#132781PurposeFRET biosensor for ATP measurements in budding yeastDepositorInsertyAT1.03 ymTq2-tdTomato
ExpressionYeastAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-PSD95-EGFP-WPRE
Plasmid#133785PurposeCre-dependent EGFP Fluorescent reporter for overexpressed postsynaptic marker PSD95 in mammalian cellDepositorAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-mRuby3-WPRE
Plasmid#99279PurposeCan be used to generate AAV virus that will express mRuby3 in the presence of CreDepositorInsertmRuby3
UseAAV and Cre/LoxAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
Fireworks RFP[PTC+] (AVA2626)
Plasmid#85444PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a PTC-containing beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBa-flag-BicD2 594-FKBP
Plasmid#64206PurposeBicaudal D protein aa1-594 (excluding start Met) with N-terminal flag tag and C-terminal FKBPDepositorInsertBicaudal D protein (Bicd2 Mouse)
TagsFKBP and flagExpressionMammalianMutationno start methionine, aa1-594Promoterchicken Beta ActinAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-Flex-dTomato-Fishell_7 (AAV2)
Viral Prep#83894-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hDlx-Flex-dTomato-Fishell_7 (#83894). In addition to the viral particles, you will also receive purified pAAV-hDlx-Flex-dTomato-Fishell_7 plasmid DNA. hDlx-driven, Cre-dependent expression of dTomato. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhDlxTagsdTomato (Cre-dependent)Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only