We narrowed to 31,332 results for: son

#87361

Expresses GdT, a dimeric green fluorescent protein

Robert Campbell

Wiens et al Chembiochem. 2016 Oct 26. doi: 10.1002/c

May 16, 2017

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#84359

FRET acceptor for RhoA donor, flanked with the far-red FP mMaroon

Ryohei Yasuda

Laviv et al Nat Methods. 2016 Oct 31. doi: 10.1038/n

Nov. 22, 2016

Academic Institutions and Nonprofits only

#67007

Expresses malE-SELP0K in E. coli

Ashutosh Chilkoti

Tang et al Nat Mater. 2016 Jan 4. doi: 10.1038/nmat

Jan. 5, 2016

Academic Institutions and Nonprofits only

#63624

KIF-R5-KIKR RNAP mutant

Andrew Ellington

Meyer et al ACS Synth Biol. 2014 Oct 7.

April 15, 2015

Industry, Academic Institutions, and Nonprofits

#57503

Localization: Membrane, Excitation: 505 / 569, Emission: 516 / 581

Michael Davidson, Loren Looger

March 4, 2015

Industry, Academic Institutions, and Nonprofits

#56291

Localization: Membrane, Excitation: 487, Emission: 509

Michael Davidson

Jan. 13, 2015

Industry, Academic Institutions, and Nonprofits

#44474

Erik Jorgensen

Frokjaer-Jensen et al Nat Methods. 2014 May;11(5):529-34. doi:

July 30, 2013

Academic Institutions and Nonprofits only