We narrowed to 1,103 results for: dTomato
-
Plasmid#132781PurposeFRET biosensor for ATP measurements in budding yeastDepositorInsertyAT1.03 ymTq2-tdTomato
ExpressionYeastAvailable sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV pCAG-FLEX-mRuby3-WPRE
Plasmid#99279PurposeCan be used to generate AAV virus that will express mRuby3 in the presence of CreDepositorInsertmRuby3
UseAAV and Cre/LoxAvailable sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
Fireworks RFP[PTC+] (AVA2626)
Plasmid#85444PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a PTC-containing beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBa-flag-BicD2 594-FKBP
Plasmid#64206PurposeBicaudal D protein aa1-594 (excluding start Met) with N-terminal flag tag and C-terminal FKBPDepositorInsertBicaudal D protein (Bicd2 Mouse)
TagsFKBP and flagExpressionMammalianMutationno start methionine, aa1-594Promoterchicken Beta ActinAvailable sinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-Flex-dTomato-Fishell_7 (AAV2)
Viral prep#83894-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hDlx-Flex-dTomato-Fishell_7 (#83894). In addition to the viral particles, you will also receive purified pAAV-hDlx-Flex-dTomato-Fishell_7 plasmid DNA. hDlx-driven, Cre-dependent expression of dTomato. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhDlxTagsdTomato (Cre-dependent)Available sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Flex-Axon-EGFP
Plasmid#135429PurposeCan be used to drive axon-enriched expression of EGFP in the presence of Cre recombinase.DepositorHas serviceAAV1Insertaxon-EGFP
UseAAV and Cre/LoxTagsGAP43 palmitoylation domainExpressionMammalianPromoterhSyn1Available sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E5-dTom-nlsdTom
Plasmid#135640PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E5 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E8-dTom-nlsdTom
Plasmid#135643PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E8 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E1-dTom-nlsdTom
Plasmid#135637PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E1 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E3-dTom-nlsdTom
Plasmid#135638PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E3 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E4-dTom-nlsdTom
Plasmid#135639PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E4 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E7-dTom-nls-dTom
Plasmid#135642PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E7 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E9-dTom-nls-dTom
Plasmid#135644PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E9 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E10-dTom-nlsdTom
Plasmid#135645PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E10 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato (AAV8)
Viral prep#60658-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato (#60658). In addition to the viral particles, you will also receive purified pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato plasmid DNA. CAG-driven, Flp-dependent expression of the voltage-gated Na+ channel mNaChBac-T2A-tdTomato. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1αAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (AAV8)
Viral prep#84446-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (#84446). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] plasmid DNA. CAG-driven, Cre-dependent expression of Jaws-KGC-tdTomato-ER2 for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA (AAV9)
Viral prep#192552-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA (#192552). In addition to the viral particles, you will also receive purified pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA plasmid DNA. CAG-driven expression of nuclear localized tdTomato. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only