We narrowed to 10,569 results for: fus
-
Plasmid#135987PurposeExpresses the FRB rapamycin-inducible domain fused to the VPR transcriptional activation domain in mammalian cellsDepositorInsertFRB domain fused to the VPR activation domain
TagsHisExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-Flex-rev-GFPFANACfullWT
Plasmid#126551PurposeAAV Flex reverse plasmid with the coding sequence of eGFP fused to the N-term of the FMRFamide gated Na channelDepositorInserteGFP N-terminal fused to FMRFamide gate sodium channel
UseAAVAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
hRad51(F86E)–Cas9(D10A)
Plasmid#125564PurposeExpresses the Rad51(F86E)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
hRad51(G151D)–Cas9(D10A)
Plasmid#125565PurposeExpresses the Rad51(G151D)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP250 pEF1a-TALE-SunTag
Plasmid#100939PurposeEmpty TALE vector fused to SunTagx10 driven by EF1a promoter, with 3xHA tag, no PURO geneDepositorInsertTALE insertion site, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Puro-DUS2L-PSKH1
Plasmid#69472PurposeExpresses DUS2L-PSKH1 fusion geneDepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLacIBD::SDRX (GB0673)
Plasmid#68183PurposeProvides the LacI Binding Domain fused to SRDX Transcriptional Repressor as a level 0 GoldenBraid partDepositorInsertLacI Binding Domain fused to SRDX Transcriptional Repressor
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-2XNLS-SpCas9-WT-NLS-3XHA-NLS-TALentry
Plasmid#69232PurposeWild type SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
SL539
Plasmid#49948PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
MLM3733
Plasmid#49964PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCru5-GGG/ACC-mEGFP-IRES-mCherry
Plasmid#49221PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCru5-UCU/ACC-mEGFP-IRES-mCherry
Plasmid#49223PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-Strep-Opa1 (SB251)
Plasmid#227600PurposeInducible expression of Strep-tagged Opa1 in Pichia pastorisDepositorInsertOPA1 (OPA1 Human)
TagsTwin-StrepTagExpressionYeastMutationcontains aa 253-960 onlyPromoterAOX1Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRL3 CTFdeltaTA-FLAG
Plasmid#217741PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRL3 (ADGRL3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-847Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRL2 CTF-FLAG
Plasmid#217707PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRL2 (ADGRL2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-824Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRE2 CTF-FLAG
Plasmid#217690PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRE2 (ADGRE2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-517Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG1 CTFdeltaTA-FLAG
Plasmid#217732PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG1 (ADGRG1 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-388Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRC2 CTFdeltaTA-FLAG
Plasmid#217718PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertCELSR2 (CELSR2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2362Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRF1 CTFdeltaTA-FLAG
Plasmid#217727PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRF1 (ADGRF1 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-572Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only