We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dFnCas9
Plasmid#201954PurposeMammalian expression plasmid of dead FnCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dFnCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A and H969A on FnCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ288 (BoCas12a)
Plasmid#138125PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized BoCas12a without promoterDepositorInsertBoCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ282 (TsCas12a)
Plasmid#138114PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized TsCas12a without promoterDepositorInsertTsCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ283 (MlCas12a)
Plasmid#138115PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized MlCas12a without promoterDepositorInsertMlCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ285 (Lb5Cas12a)
Plasmid#138120PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a without promoterDepositorInsertLb5Cas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ286 (CMaCas12a)
Plasmid#138122PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized CMaCas12a without promoterDepositorInsertCMaCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ287 (BsCas12a)
Plasmid#138123PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized BsCas12a without promoterDepositorInsertBsCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_Luciferase_sgRNA
Plasmid#155109Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
KJ901: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN901: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-KRAB
Plasmid#121830PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-